Skip to Content
Merck
CN

EHU085641

MISSION® esiRNA

targeting human CTSB

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGGGTCTGAAGGACTGGATTGGCCAAACATCAGACCTGTCTTCCAAGGAGACCAAGTCCTGGCTACATCCCAGCCTGTGGTTACAGTGCAGACAGGCCATGTGAGCCACCGCTGCCAGCACAGAGCGTCCTTCCCCCTGTAGACTAGTGCCGTAGGGAGTACCTGCTGCCCCAGCTGACTGTGGCCCCCTCCGTGATCCATCCATCTCCAGGGAGCAAGACAGAGACGCAGGAATGGAAAGCGGAGTTCCTAACAGGATGAAAGTTCCCCCATCAGTTCCCCCAGTACCTCCAAGCAAGTAGCTTTCCACATTTGTCACAGAAATCAGAGGAGAGACGGTGTTGGGAGCCCTTTGGAGAACGCCAGTCTCCCAGGCCCCCTGCATCTATCGAGTTTGCAATGTCACAACCTCTCTGATCTTGTGCTCAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fengming Gong et al.
Molecular cancer, 12(1), 125-125 (2013-10-22)
The lung squamous cell carcinoma survival rate is very poor despite multimodal treatment. It is urgent to discover novel candidate biomarkers for prognostic assessment and therapeutic targets to lung squamous cell carcinoma (SCC). Herein a two-dimensional gel electrophoresis and ESI-Q-TOF
Xin Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 390-396 (2018-08-14)
Resistance to adjuvant radiotherapy is a major cause of treatment failure in patients with glioblastoma (GBM). Recently, the role of lysosome, especially lysosomal proteases, in radioresistance is being paid more and more attention to. Here, we investigated the radioresistant role
Ana Mitrović et al.
European journal of cell biology, 96(6), 622-631 (2017-05-13)
Cathepsins B and X are lysosomal cysteine carboxypeptidases suggested as having a redundant role in cancer. They are involved in a number of processes leading to tumor progression but their role in the epithelial-mesenchymal transition (EMT) remains unknown. We have
Man Kyu Shim et al.
Biomaterials, 261, 120347-120347 (2020-09-06)
Chemotherapy has shown remarkable therapeutic efficacy for various types of cancer. However, drug resistance reduces the effectiveness and sensitivity of chemotherapy, leading treatment failure and cancer relapse in many clinical indications. Herein, we propose cancer-specific drug-drug nanoparticles (DD-NPs) that improve
Man Kyu Shim et al.
Journal of controlled release : official journal of the Controlled Release Society, 294, 376-389 (2018-12-15)
Cancer nanomedicine using nanoparticle-based delivery systems has shown outstanding promise in recent decades for improving anticancer treatment. However, limited targeting efficiency, low drug loading efficiency and innate toxicity of nanoparticles have caused severe problems, leaving only a few available in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service