Skip to Content
Merck
CN

EHU076601

MISSION® esiRNA

targeting human SMARCA4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGACCTGAATGAGGAGGAAACCATTCTCATCATCCGGCGTCTCCACAAAGTGCTGCGGCCCTTCTTGCTCCGACGACTCAAGAAGGAAGTCGAGGCCCAGTTGCCCGAAAAGGTGGAGTACGTCATCAAGTGCGACATGTCTGCGCTGCAGCGAGTGCTCTACCGCCACATGCAGGCCAAGGGCGTGCTGCTGACTGATGGCTCCGAGAAGGACAAGAAGGGCAAAGGCGGCACCAAGACCCTGATGAACACCATCATGCAGCTGCGGAAGATCTGCAACCACCCCTACATGTTCCAGCACATCGAGGAGTCCTTTTCCGAGCACTTGGGGTTCACTGGCGGCATTGTCCAAGGGCTGGACCTGTACCGAGCCTCGGGTAAATTTGAGCTTCTTGATAGAATTCTTCCCAAACTCCGAGCAACCAACCACAAAGTGCTGCTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wentao Sun et al.
European journal of pharmacology, 875, 173038-173038 (2020-02-28)
High glucose (HG)-induced oxidative damage of retinal ganglion cells (RGCs) contributes to the pathogenesis of diabetic retinopathy, a severe complication of diabetes mellitus. Brahma-related gene 1 (Brg1) has currently emerged as a cytoprotective protein that alleviates oxidative damage induced by
Xiaoping Liu et al.
Free radical biology & medicine, 160, 820-836 (2020-09-21)
Brahma-related gene 1 (BRG1) regulates the chromatin structure and expression of cardiac genes. Although BRG1 is downregulated in adult cardiomyocytes, it is reactivated during cardiac stress. The role of BRG1 in acute myocardial infarction (AMI) has not been clearly defined.
Tatiana Souslova et al.
Molecular neurobiology, 54(10), 8263-8277 (2016-12-04)
Five-prime repressor element under dual repression binding protein-1 (Freud-1)/CC2D1A is genetically linked to intellectual disability and implicated in neuronal development. Freud-1 represses the serotonin-1A (5-HT1A) receptor gene HTR1A by histone deacetylase (HDAC)-dependent or HDAC-independent mechanisms in 5-HT1A-negative (e.g., HEK-293) or
Shujie Song et al.
Molecular cancer research : MCR, 18(12), 1777-1788 (2020-08-29)
The NF-E2-related factor 2 (referred to as NRF2) transcription factor binds antioxidant responsive elements within the promoters of cytoprotective genes to induce their expression. Next-generation sequencing studies in lung cancer have shown a significant number of activating mutations within the
Yanru Li et al.
Journal of biochemical and molecular toxicology, 32(4), e22044-e22044 (2018-02-20)
Accumulating evidence has reported that microRNA-144-3p (miR-144-3p) is highly related to oxidative stress and apoptosis. However, little is known regarding its role in cerebral ischemia/reperfusion-induced neuronal injury. Herein, our results showed that miR-144-3p expression was significantly downregulated in neurons following

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service