Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MMP2(4313)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Yonghao Gu et al.
Ophthalmic research, 55(2), 70-75 (2015-11-28)
Proliferative retinal angiogenesis may severely impair the retina. Previous studies have indicated that matrix metalloproteinase (MMP)-2 and MMP-9 play important roles in the process of retinal angiogenesis. In this study, we suppressed MMP-2 and MMP-9 expression with RNA interference (RNAi)
Huaping Zhao et al.
Life sciences, 256, 117897-117897 (2020-06-06)
Glioma is the most common brain malignancy and surgical resection is the primary option for patient with glioma. Anesthetics could be used to inhibit cancer dissemination and metastasis during surgery. This study aims to assess the function of volatile anesthetic
Xi Cheng et al.
Scientific reports, 7(1), 12362-12362 (2017-09-30)
Studies indicate that the chemokine receptor is responsible for poor prognosis of hepatocellular carcinoma (HCC) patients. In this study, we initially demonstrated that CCR4 is overexpressed in HCC specimens, and its elevation in HCC tissues positively correlates with tumor capsule
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU016971-20UG | 04061828565238 |
| EHU016971-50UG | 04061828339556 |