Skip to Content

Dear Customer:

The current international situation is complex and volatile, and uncertain tariff policies may potentially impact our product prices. Given these uncertainties, we value your understanding regarding order-related matters.

If you decide to place an order during this period, we reserve the right to adjust the price based on the evolving situation. We understand that market changes may cause inconvenience. We will negotiate with you if there’s a significant price fluctuation due to tariff policy changes before the order’s actual delivery, and in such cases we may adjust or cancel the order as necessary.

Merck
CN
All Photos(1)

Key Documents

Safety Information

SH0531

Sigma-Aldrich

MISSION® shRNA Human Gene Family Set, Lentiviral Particles

Tumor Suppressors

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
¥3,096.05
50 μG
¥5,521.21

¥3,096.05


Estimated to ship on2025年7月18日Details


Request a Bulk OrderRequest more information

Select a Size

Change View
20 μG
¥3,096.05
50 μG
¥5,521.21

About This Item

UNSPSC Code:
41106609
NACRES:
NA.51

¥3,096.05


Estimated to ship on2025年7月18日Details


Request a Bulk OrderRequest more information

Quality Level

product line

MISSION®

storage temp.

−70°C

Gene Information

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU072451EMU085071EMU069331
esiRNA cDNA target sequence

TCATTCTCTTACAACCACCTTCCATATACCTTCAAGTCAACATTACCAAGAAGAGCATTCACCATCATTGTCAGGATCAGATTCTCTTCTTCAAATAACCACTCCTGTGGTGGCTTCAACTGTAGGTAACCCAAATCAGCATTCAGCAACAATGTCAACACCAGCTATTCATGTCTCAACTTATCACACGGCCCCTACTGAAGTGTCTGCTGCGTTTGAAGAACAGCCTGTCTCACCACACATTGGAGGAATGCCGTCACCAATTCAACACGATTTTCCTGCACTAGTGATGATACTCATAATTTTGGGCGTGATGGCAGGGATTATCGGAACTATCCTTCTTATCTCTTACTGTATCAGCCGAATGACAAAGAAAAGTTCAGTTGACATCCAATCTCCTGAGGGTGGTGACAACAGTGTGCCTTTGAGTTCTATTGAGCAGACTCCTAATGAAGAGTCCTCCAATGTTTGAAAGACCTCAAGGAAAACAAGACTTCAATCAATGGGAAA

esiRNA cDNA target sequence

GGGCAGGTTGAGTTCATTGTAAATAATTGTGTAAATCACTGTTCTAGTAATTTAAAAATAACATTAATTTTTCTACAAAATGCGAGATTTATAAATGTTTGAAATTGTACCTATTGATAATTAATGGTAAGTTTACTTAAAATAAATGTATCCCTTATTTCTTATCTGCATTTCTCATTTCCAGATGAAAGTTTAGTTATCAGAGATGTTTCAGCACACACAAAAGCCACTTTTCAGTACTTGTTCACATGCACTGACGAGCTAATTAGCAGCAGAAGTGGTTTCTGGAATGATGAACACCTTAATCATTCTGTTAGAACAGATTAGACAGTTCCTACCTCAGCATTTTCAGAAAACACACTTTCAAGGCCAAAAGCCATCATCATCAGTAGAGTCTCCCCTTGCTGAGACCTAATTATCTCCGGGGTTCCATC

esiRNA cDNA target sequence

TGACAGCGAAGGCAATGTAGTGAACAAACCCGACAGCCATGGTGGCAGCCTCGAATGGACAAAGATCTGTGAGAAGTCCTCTAAAGTGATCACCTTCATCGACTTGGCTGGCCACGAGAAGTACCTTAAGACCACTGTTTTTGGCATGACTGGCCACTTGCCTGACTTCTGCATGCTCATGGTGGGCAGCAATGCTGGCATTGTGGGGATGACCAAGGAGCATCTGGGCTTGGCATTGGCACTCAATGTACCTGTGTTTGTGGTTGTCACCAAGATTGACATGTGTCCTGCCAACATCCTTCAAGAAACCCTGAAGCTGCTACAGCGCCTGCTGAAGTCACCAGGCTGCCGGAAGATCCCTGTCCTGGTGCAGAGCAAAGATGATGTGATTGTCACAGCCTCCAACTTCAGCTCTGAGAGGATGTGCCCGATATTCCAGATCTCCAATGTCACAGGTGAGAACCTTGACCTGCTCAAGATGTTCCTCAACCTCCTGTCC

esiRNA cDNA target sequence

CACCAGTTTCGGACCAGTTTCAGACCACGATATGGAGTATACAATAGATGTGTTTTTCCGTCAAAGTTGGAAGGATGAAAGATTAAAATTCAAAGGACCCATGACAGTGCTCCGGCTAAACAACCTTATGGCCAGTAAAATCTGGACTCCAGATACATTTTTCCACAATGGAAAGAAGTCTGTGGCCCACAACATGACCATGCCTAATAAGCTCCTGCGTATCACAGAGGATGGCACTCTGCTGTACACCATGAGGTTGACCGTGAGAGCTGAATGCCCAATGCACTTGGAAGACTTCCCTATGGATGCCCATGCCTGCCCACTAAAATTCGGAAGCTATGCTTATACAAGAGCAGAAGTTGTCTATGAGTGGACCAGAGAGCCAGCCCGTTCAGTGGTTGTAGCAGAAGATGGGTCACGTTT

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | mouse accession no.

ENSMUSG00000051839

Ensembl | mouse accession no.

ENSMUSG00000025059

Ensembl | mouse accession no.

ENSMUSG00000042535

Ensembl | mouse accession no.

ENSMUSG00000010803

Gene Information

mouse ... GYPA(14934), Gypa(14934)

Gene Information

mouse ... GYK(14933), Gyk(14933)

Gene Information

mouse ... GTPBP1(14904), Gtpbp1(14904)

Gene Information

mouse ... GABRA1(14394), Gabra1(14394)

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

Lentiviral particles (representational, plate titer) are provided in 96-well plates that are barcoded for simple identification. Aliquots of 4 x 50μl are provided to prevent the need for excessive freeze/thaw, and maximize functional viral particles. Each gene family set is representationally titered (10% of clones). Fully titered sets are also available, for more information inquire at RNAi@sial.com. A CD containing RefSeq, gene description, gene symbol, clone ID, hairpin sequence, locus link, and plate map positions are provided with the gene family set.

Application

MISSION® shRNA human gene family set, lentiviral particles has been used in pRb downregulation.[1]

Other Notes

Each MISSION shRNA clone is constructed within the lentivirus plasmid vector, pLKO.1-Puro, followed by transformation into Escherichia coli. The pLKO.1-Puro vector contains bacterial (ampicillin) and mammalian (puromycin) antibiotic resistance genes for selection of inserts in either bacterial or mammalian cell lines. Each clone set consists of an average of 3-5 constructs that have been designed against each target gene using a proprietary algorithm. Therefore, a range of knockdown efficiency, with at least one construct from each gene set being >70%, can be expected when using these clones. This allows one to examine the effect of loss of gene function over a large series of gene knockdown efficiencies. Each shRNA construct has been cloned and sequence verified to ensure a match to the target gene.
For a detailed listing of other available gene family sets, visit the gene family set website.
Number of Genes: 73, Number of Clones: 575
The exact gene and clone count at time of purchase may vary slightly as the TRC library is continually updated.

Legal Information

Use of this product is subject to one or more license agreements. For details, please see http://sigmaaldrich.com/missionlicense .
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Personal Protective Equipment

dust mask type N95 (US), Eyeshields, Gloves

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

HPV-16 E7 expression up-regulates phospholipase D activity and promotes rapamycin resistance in a pRB-dependent manner.
Rabachini T, et al.
BMC Cancer, 18(1), 485-485 (2018)
Cynthia Osborne et al.
The oncologist, 9(4), 361-377 (2004-07-22)
Carcinogenesis is a multistep process characterized by genetic alterations that influence key cellular pathways involved in growth and development. Oncogenes refer to those genes whose alterations cause gain-of-function effects, while tumor suppressor genes cause loss-of-function effects that contribute to the
Tatiana Rabachini et al.
BMC cancer, 18(1), 485-485 (2018-04-29)
Human Papillomavirus (HPV) infection is the main risk factor for the development and progression of cervical cancer. HPV-16 E6 and E7 expression is essential for induction and maintenance of the transformed phenotype. These oncoproteins interfere with the function of several
Emanuela Vattemi et al.
Drug news & perspectives, 20(8), 511-520 (2007-12-15)
Cancer formation is a multistep process that involves the sequential activation of oncogenes as well as the inactivation of tumor suppressor genes often in the same clone of cells. These genetic changes generate concomitant phenotypic changes in the tumor cells
Jonathan C Berger et al.
Cancer biology & therapy, 4(8), 805-812 (2005-08-06)
In the past decade, findings from various disciplines of research have stimulated a reevaluation of fundamental concepts of the biology of metastasis. The convergence of two avenues of research has largely been responsible for this shift. First, clinical and experimental

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service