HMI0371
MISSION® microRNA Mimic
hsa-miR-21
Synonym(s):
hsa-miR-21-5p
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
Recommended Products
product line
MISSION®
form
solid
mature sequence
UAGCUUAUCAGACUGAUGUUGA
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Other Notes
miRBase V18 Mature ID update: hsa-miR-21-5p
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
11 - Combustible Solids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
常规特殊物品
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
Sorry, we don't have COAs for this product available online at this time.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Microvesicles Derived from Adult Human Bone Marrow and Tissue Specific Mesenchymal Stem Cells Shuttle Selected Pattern of miRNAs
Collino F., Deregibus M.C., Bruno S., Sterpone L., Aghemo G., et al.
PLoS ONE, 5 (2010)
Lina Cai et al.
Oncology letters, 15(4), 5213-5219 (2018-03-20)
Numerous studies have indicated that microRNAs (miRs), a group of small non-coding RNAs, are determining regulatory elements involved in the pathogenesis of various types of cancer, including cervical cancer (CC). Although miR-21-5p upregulation has been demonstrated to associate with tumorigenesis
C Probert et al.
Oncogene, 38(10), 1751-1763 (2018-10-26)
The role of extracellular vesicles (EVs) as vehicles for cell-to-cell communication between a tumour and its environment is a relatively new concept. The hypothesis that EVs may be critical in co-opting tissues by tumours to generate distant metastatic niches is
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service