HMC0003
MISSION® miRNA, Negative Control 2
Sequence from Caenorhabditis elegans with no homology to human gene sequences
Synonym(s):
Mature Sequence: CGGUACGAUCGCGGCGGGAUAUC
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
product line
MISSION®
form
liquid
storage temp.
−20°C
General description
MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 2 is based upon a Caenorhabditis elegans sequence.
Application
MISSION® miRNA, Negative Control 2 has been used as a negative control for miRNA transfections.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
NOD2 expression is regulated by microRNAs in colonic epithelial HCT116 cells.
Inflammatory bowel diseases, 20, 126-126 (2014)
miRepress: modelling gene expression regulation by microRNA with non-conventional binding sites.
Scientific Reports, 6, 22334-22334 (2016)
Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p.
Stem Cells, 33, 3266-3266 (2015)
Scientific reports, 9(1), 10079-10079 (2019-07-14)
Translation of genes is regulated by many factors including microRNAs (miRNAs). miRNA profiling of lesional and non-lesional epidermal RNA from 18 vitiligo patients revealed significant upregulation of 29 miRNAs in the lesional epidermis, of which 6 miRNAs were transfected in
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
The Journal of Physiology, 3, 364-377 (2011)
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service