HMC0003
MISSION® miRNA, Negative Control 2
Sequence from Caenorhabditis elegans with no homology to human gene sequences
Synonym(s):
Mature Sequence: CGGUACGAUCGCGGCGGGAUAUC
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
UNSPSC Code:
12352200
NACRES:
NA.51
Recommended Products
product line
MISSION®
form
liquid
storage temp.
−20°C
General description
MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 2 is based upon a Caenorhabditis elegans sequence.
Application
MISSION® miRNA, Negative Control 2 has been used as a negative control for miRNA transfections.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Physiology, 3, 364-377 (2011)
Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p.
Barter MJ et al.
Stem Cells, 33, 3266-3266 (2015)
miRepress: modelling gene expression regulation by microRNA with non-conventional binding sites.
Ghosal S et al.
Scientific Reports, 6, 22334-22334 (2016)
NOD2 expression is regulated by microRNAs in colonic epithelial HCT116 cells.
Chuang AY et al.
Inflammatory bowel diseases, 20, 126-126 (2014)
Shuhei Yamada et al.
Scientific reports, 6, 19225-19225 (2016-01-13)
MicroRNAs (miRNAs) are non-coding RNAs involved in various biological processes by regulating their target genes. Green tea polyphenol (-)-epigallocatechin-3-O-gallate (EGCG) inhibits melanoma tumor growth by activating 67-kDa laminin receptor (67LR) signaling. To examine the effect of EGCG on miRNA expression
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service