HMC0002
MISSION® miRNA, Negative Control 1
Sequence from Arabidopsis thaliana with no homology to human gene sequences
Synonym(s):
Mature Sequence: GGUUCGUACGUACACUGUUCA
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
UNSPSC Code:
12352200
NACRES:
NA.51
product line
MISSION®
form
solid
storage temp.
−20°C
General description
MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.
Application
MISSION® miRNA, Negative Control 1 has been used as a negative control for miRNA transfections.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
常规特殊物品
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Pathology, 3, 364-377 (2011)
The Effects of Sequence Variation on Genome-wide NRF2 Binding--New Target Genes and Regulatory SNPs.
Kuosmanen SM et al.
Nucleic Acids Research, 44, 1760-1760 (2016)
Yumeng Wang et al.
Genome research, 27(7), 1112-1125 (2017-04-16)
RNA editing, a widespread post-transcriptional mechanism, has emerged as a new player in cancer biology. Recent studies have reported key roles for individual miRNA editing events, but a comprehensive picture of miRNA editing in human cancers remains largely unexplored. Here
MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis.
Danza K et al.
Oncotarget, 6, 471-471 (2015)
Lijuan Chen et al.
Molecular medicine reports, 18(3), 2571-2580 (2018-07-18)
MicroRNA (miR)‑200b‑3p is downregulated in multiple human cancer types. Wnt signaling serves a role in human colorectal cancer (CRC). The present study aimed to examine the effect of miR‑200b‑3p on human CRC and its potential association with Wnt signaling. The
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service