HMC0002
MISSION® miRNA, Negative Control 1
Sequence from Arabidopsis thaliana with no homology to human gene sequences
Synonym(s):
Mature Sequence: GGUUCGUACGUACACUGUUCA
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
UNSPSC Code:
12352200
NACRES:
NA.51
Recommended Products
product line
MISSION®
form
solid
storage temp.
−20°C
General description
MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.
Application
MISSION® miRNA, Negative Control 1 has been used as a negative control for miRNA transfections.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
13 - Non Combustible Solids
WGK
WGK 3
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
常规特殊物品
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Lot/Batch Number
Sorry, we don't have COAs for this product available online at this time.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Pathology, 3, 364-377 (2011)
MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis.
Danza K et al.
Oncotarget, 6, 471-471 (2015)
A Egli et al.
American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 16(2), 650-660 (2015-10-16)
Human (Homo sapiens) micro-RNAs (hsa-miRNAs) regulate virus and host-gene translation, but the biological impact in patients with human cytomegalovirus (hCMV) infection is not well defined in a clinically relevant model. First, we compared hsa-miRNA expression profiles in peripheral blood mononuclear
Yumeng Wang et al.
Genome research, 27(7), 1112-1125 (2017-04-16)
RNA editing, a widespread post-transcriptional mechanism, has emerged as a new player in cancer biology. Recent studies have reported key roles for individual miRNA editing events, but a comprehensive picture of miRNA editing in human cancers remains largely unexplored. Here
The Effects of Sequence Variation on Genome-wide NRF2 Binding--New Target Genes and Regulatory SNPs.
Kuosmanen SM et al.
Nucleic Acids Research, 44, 1760-1760 (2016)
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service