Skip to Content
Merck
CN

HMC0002

MISSION® miRNA, Negative Control 1

Sequence from Arabidopsis thaliana with no homology to human gene sequences

Synonym(s):

Mature Sequence: GGUUCGUACGUACACUGUUCA

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
12352200
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

product line

MISSION®

form

solid

storage temp.

−20°C

General description

MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.

Application

MISSION® miRNA, Negative Control 1 has been used as a negative control for miRNA transfections.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

13 - Non Combustible Solids

wgk

WGK 3

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

The Effects of Sequence Variation on Genome-wide NRF2 Binding--New Target Genes and Regulatory SNPs.
Kuosmanen SM et al.
Nucleic Acids Research, 44, 1760-1760 (2016)
MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis.
Danza K et al.
Oncotarget, 6, 471-471 (2015)
Yumeng Wang et al.
Genome research, 27(7), 1112-1125 (2017-04-16)
RNA editing, a widespread post-transcriptional mechanism, has emerged as a new player in cancer biology. Recent studies have reported key roles for individual miRNA editing events, but a comprehensive picture of miRNA editing in human cancers remains largely unexplored. Here
A Egli et al.
American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 16(2), 650-660 (2015-10-16)
Human (Homo sapiens) micro-RNAs (hsa-miRNAs) regulate virus and host-gene translation, but the biological impact in patients with human cytomegalovirus (hCMV) infection is not well defined in a clinically relevant model. First, we compared hsa-miRNA expression profiles in peripheral blood mononuclear
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Pathology, 3, 364-377 (2011)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service