Select a Size
CN¥7,268.37
Estimated to ship onApril 17, 2025Details
Select a Size
About This Item
CN¥7,268.37
Estimated to ship onApril 17, 2025Details
Recommended Products
description
targeting mouse LOC546967
form
lyophilized powder
esiRNA cDNA target sequence
CTTGGGCCAACTGACTAAGGAGGGGATCCGCCAGCAGCTAGAACTGGGCCGATTTCTGAGGAGGCGTTACAAGGCTTTCCTGAGCCCTGAGTACAAGCGAGAAGAGGTGTACATCCGCAGCACAGACTTTGACCGGACATTGGAGAGTGCACAAGCCAACCTGGCTGGGCTCTTCCCTGAGGCTGCCCCTGGAAGTCCTGAGACTGACTGGAAGCCCATTCCAGTGCACACAGTGCCTGTGTCTGAGGACAAGTTGCTGAGGTTCCCCATGCGCAGCTGTCCTCGATACCATGAGCTGTTACGAGAGTCCACAGAGG
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... LOC546967(100503991)
1 of 4
This Item | V800046 | 103776 | F5879 |
---|---|---|---|
form solid | form solid | form solid | form powder |
density 1.78 g/mL at 25 °C (lit.) | density - | density - | density - |
anion traces chloride (Cl-): ≤50 mg/kg | anion traces - | anion traces chloride (Cl-): ≤0.0005%, nitrate (NO3-): ≤0.01% | anion traces - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
11 - Combustible Solids
WGK
WGK 1
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service