Skip to Content
Merck
CN

EMU196041

MISSION® esiRNA

targeting mouse Plg

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCACAGCAAAGAGCAGCAATGCGTGATCATGGCGGAGAACAGCAAGACTTCCTCCATCATCCGGATGAGAGACGTCATCTTATTCGAAAAGAGAGTGTATCTGTCAGAATGTAAGACCGGCATCGGCAACGGCTACAGAGGAACCATGTCCAGGACAAAGAGTGGTGTTGCCTGTCAAAAGTGGGGTGCCACGTTCCCCCACGTACCCAACTACTCTCCCAGTACACATCCCAATGAGGGACTAGAAGAGAACTACTGTAGGAACCCAGACAATGATGAACAAGGGCCTTGGTGCTACACTACAGATCCGGACAAGAGATATGACTACTGCAACATTCCTGAATGTGAAGAGGAATGCATGTACTGCAGTGGAGAAAAGTATGAGGGCAAAATCTCCAAGACCATGTCTGGACTTGACTGCCAGGCCTGGGATTCTCAGAGCCCACATGCTCATGGATACATCCCTGCCAAATTTCCAAGCAAGAACCTGAAGATGAATTATTGCCGCAACC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
Karen A Newell-Litwa et al.
The Journal of cell biology, 210(2), 225-242 (2015-07-15)
RhoGTPases organize the actin cytoskeleton to generate diverse polarities, from front-back polarity in migrating cells to dendritic spine morphology in neurons. For example, RhoA through its effector kinase, RhoA kinase (ROCK), activates myosin II to form actomyosin filament bundles and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service