Skip to Content
Merck
CN

EMU086651

MISSION® esiRNA

targeting mouse Cd82

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTGTGTCAAAGTCACCAAGTATTTCCTCTTCCTCTTCAACTTGCTGTTCTTTATCCTGGGTGCTGTGATCCTGGGCTTCGGGGTGTGGATTCTTGCAGACAAGAACAGCTTCATTTCCGTCCTACAAACCTCATCCAGCTCGCTGCAGGTGGGGGCTTACGTCTTCATCGGTGTGGGCGCCATCACCATAGTGATGGGCTTCCTGGGCTGTATCGGTGCTGTCAATGAGGTCCGCTGCTTGCTGGGTCTGTACTTTGTCTTCCTTCTGCTGATCCTCATCGCACAGGTGACCGTAGGGGTCCTCTTCTACTTCAACGCTGACAAGCTGAAGAAGGAGATGGGGAACACAGTGATGGACATCATTCGCAACTACACTGCCAATGCCACCAGTAGCCGCGAGGAGGCCTGGGACTACGTGCAGGCGCAGGTCAAGTGCTGTGGCTGGGTCAGCCACTACAACTGGACAGAGAACGAGGAGCTCATGGGCTTTACCAAGACCACTTACCCATGCTCCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qing-Hui Zhang et al.
Digestive diseases and sciences, 60(7), 1967-1976 (2015-02-06)
This study was to investigate the effects and mechanisms of miR-362-3p on regulation of gastric cancer (GC) cell metastasis potential. We detected miR-362-3p level in GC and adjacent normal tissues and investigated the relationship with clinicopathological factors. Next, we analyzed
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service