Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCACGACAGAAGGAGAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGATTGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTCCTGTGTGCCGCTGATGCGCTGTGCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCAGAGAGCAACATCACCATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGCAGATGTGAATGCAGACCAAAGAAAGACAGAACAAAGCCAGAAAATCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCATT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... VEGFA(22339), Vegfa(22339)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yang Ding et al.
Biomaterials, 35(25), 7214-7227 (2014-05-31)
We described here the mechanisms by which small interfering RNA (siRNA) molecules incorporated in reconstituted high density lipoprotein (rHDL) were efficiently transferred into the cytoplasm of cells to perform target-specific therapy of tumor angiogenesis. Using fluorescent-tagged apolipoprotein A-I (apoA-I) and
Xue-jun Shao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(5), 2051-2062 (2015-07-24)
Down-expression of microRNA-497 (miR-497) was often found in malignancies. The purposes of this study were to determine the expression of miR-497 in human osteosarcoma and to establish the association between miR-497 expression with cell survival and the sensitivity to cisplatin
Zhili Wen et al.
PloS one, 9(9), e104666-e104666 (2014-09-25)
MicroRNAs have been appreciated in various cellular functions, including the regulation of angiogenesis. Mesenchymal-stem-cells (MSCs) transplanted to the MI heart improve cardiac function through paracrine-mediated angiogenesis. However, whether microRNAs regulate MSC induced angiogenesis remains to be clarified. Using microRNA microarray
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU062931-50UG | 04061828249817 |
| EMU062931-20UG | 04061831338850 |