Skip to Content
Merck
CN

EMU053941

MISSION® esiRNA

targeting mouse Itgae

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTGGACCACTACAAGGAACCCTCTGCCATCTTCCAGCTGCCCTACGAGAAGGACTGCAAGAACAAAGTGTTCTGCATCGCTGAGATCCAGCTGACCACCAACATCTCCCAGCAGGAACTGGTGGTGGGCGTCACAAAGGAGGTGACCATGAACATCAGCCTGACTAACTCTGGAGAGGATTCCTACATGACAAACATGGCTCTCAATTATCCCAGAAACTTACAGTTTAAGAAGATACAAAAGCCAGTATCTCCAGATGTTCAGTGTGATGACCCCAAGCCAGTTGCTTCTGTCCTGGTCATGAACTGCAAGATTGGTCACCCCATACTCAAGAGATCATCTGTGAATGTCTCAGTAACTTGGCAGCTAGAGGAGAGTGTCTTTCCAAATAGGACAGCAGATATCACTGTGACCATCTCCAATTCCAATGAGAAGTCTTTGGCCAGAGAGACACGCAGCCTTCAAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jayashree Dolpady et al.
Journal of diabetes research, 2016, 7569431-7569431 (2016-01-19)
The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D) via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal
Verena Moosbrugger-Martinz et al.
Journal of cellular and molecular medicine, 20(5), 930-938 (2016-03-05)
Atopic dermatitis (AD) is a widespread inflammatory skin disease with an early onset, characterized by pruritus, eczematous lesions and skin dryness. This chronic relapsing disease is believed to be primarily a result of a defective epidermal barrier function associated with
Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service