Skip to Content
Merck
CN

EMU052221

MISSION® esiRNA

targeting mouse Kdr

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAATGTGGGGCTTGATTTCACCTGGCACTCTCCACCTTCAAAGTCTCATCATAAGAAGATTGTAAACCGGGATGTGAAACCCTTTCCTGGGACTGTGGCGAAGATGTTTTTGAGCACCTTGACAATAGAAAGTGTGACCAAGAGTGACCAAGGGGAATACACCTGTGTAGCGTCCAGTGGACGGATGATCAAGAGAAATAGAACATTTGTCCGAGTTCACACAAAGCCTTTTATTGCTTTCGGTAGTGGGATGAAATCTTTGGTGGAAGCCACAGTGGGCAGTCAAGTCCGAATCCCTGTGAAGTATCTCAGTTACCCAGCTCCTGATATCAAATGGTACAGAAATGGAAGGCCCATTGAGTCCAACTACACAATGATTGTTGGCGATGAACTCACCATCATGGAAGTGACTGAAAGAGATGCAGGAAACTACACGGTCATCCTCACCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming-Heng Wu et al.
Angiogenesis, 17(4), 839-849 (2014-04-11)
Galectin-1 (Gal-1) is a β-galactoside-binding lectin that regulates endothelial cell migration, proliferation, and adhesion. However, the effect of Gal-1 on vascular permeability and the underlying mechanisms are unclear. We found that high Gal-1 expression was associated with elevated tumor vascular
Dongshi Chen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3472-3484 (2014-04-26)
Regorafenib, a multikinase inhibitor targeting the Ras/Raf/MEK/ERK pathway, has recently been approved for the treatment of metastatic colorectal cancer. However, the mechanisms of action of regorafenib in colorectal cancer cells have been unclear. We investigated how regorafenib suppresses colorectal cancer
Richard P Hulse et al.
Clinical science (London, England : 1979), 129(8), 741-756 (2015-07-23)
Diabetic peripheral neuropathy affects up to half of diabetic patients. This neuronal damage leads to sensory disturbances, including allodynia and hyperalgesia. Many growth factors have been suggested as useful treatments for prevention of neurodegeneration, including the vascular endothelial growth factor

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service