Skip to Content
Merck
CN

EMU051441

MISSION® esiRNA

targeting mouse Nfat5

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCTCTCCAGCATCCATGTCTGCATTGCAAACCAGTATAAACCAACCAGACATGCAGCAGTCTCCTCTTTATTCCCCGCAGAACAACATCCCTGGAATCCAAGGAAGCACTTCTTCACCCCAGCCACAGGCTACTTTATTTCACAACACTACAGGAGGCACAATAAACCAAATACAAAATTCTCCTGGCTCATCTCAGCAGACTTCAGGAATGTTCTTATTTGGCATTCAAAATAATTGTAGTCAGCTTTTAACCTCCGGACCAGCTACATTGCCAGATCAGCTGATGGCCATAAATCAGCAGGGCCAACCACAAAATGAGGGCCAATCTTCTGTGACAACACTTCTTTCTCAGCAAATGCCAGAGACTTCCCCACTGGCCTCCTCTGTGAACAGCAGTCAGAACATGGAAAAGATTGATTTGCTTGTTTCATTGCAAAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Margrit Hollborn et al.
Molecular vision, 21, 360-377 (2015-04-17)
High intake of dietary salt increases extracellular osmolarity, which results in hypertension, a risk factor of neovascular age-related macular degeneration. Neovascular retinal diseases are associated with edema. Various factors and channels, including vascular endothelial growth factor (VEGF) and aquaporins (AQPs)
Nam-Hoon Kim et al.
European journal of immunology, 44(9), 2721-2736 (2014-07-22)
NFAT5 (nuclear factor of activated T cells), a well-known osmoprotective factor, can be activated by isotonic stimuli such as Toll-like receptor (TLR) triggering. However, it is unclear how NFAT5 discriminates between isotonic and hypertonic stimuli to produce different functional and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service