Skip to Content
Merck
CN

EMU050011

MISSION® esiRNA

targeting mouse Snai1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACCCACTCGGATGTGAAGAGATACCAGTGCCAGGCCTGTGCCCGAACCTTCTCCCGCATGTCCTTGCTCCACAAGCACCAAGAGTCTGGCTGCTCCGGAGGCCCTCGCTGACCCTGCTACCTCCCCATCCTCGCTGGCATCTTCCCGGAGCTCACCCTCCTCCTCACTGCCAGGACTCCTTCCAGCCTTGGTCCGGGGACCTGTGGCGTCCATGTCTGGACCTGGTTCCTGCTTGGCTCTCTTGGTGGCCTTTGCCGCAGGTGGCTGATGGAGTGCCTTTGTACCCGCCCAGAGCCTCCTACCCCTCAGTATTCATGAGGTGTAGCCTCTGGACACAGCTGCTTCGAGCCATAGAACTAAAGCCAACCCACTGGCTGGGAAGCTTGAACCCCGCTCAGGGGACCCCACTTCCCTACCTCCCTCAAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qingsheng Dong et al.
PloS one, 9(6), e98651-e98651 (2014-06-25)
Glioblastoma is an extraordinarily aggressive disease that requires more effective therapeutic options. Snail family zinc finger 1, dysregulated in many neoplasms, has been reported to be involved in gliomas. However, the biological mechanisms underlying SNAI1 function in gliomas need further
Wai-Kin So et al.
FEBS letters, 588(21), 3998-4007 (2014-09-28)
Aberrant epidermal growth factor receptor (EGFR) activation is associated with ovarian cancer progression. In this study, we report that the EGFR ligand amphiregulin (AREG) stimulates cell invasion and down-regulates E-cadherin expression in two human ovarian cancer cell lines, SKOV3 and
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Prathap Kumar S Mahalingaiah et al.
Journal of cellular physiology, 230(8), 1916-1928 (2014-12-30)
Oxidative injury to cellular macromolecules has been suggested as a common pathway shared by multiple etiological factors for kidney cancer. Whether the chronic oxidative stress alone is sufficient to induce malignant transformation in human kidney cells is not clear. Therefore

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service