EMU047451
MISSION® esiRNA
targeting mouse Frap1
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCACATTGACTTTGGGGACTGCTTTGAGGTCGCTATGACCAGAGAGAAATTTCCAGAAAAGATTCCATTTAGACTAACAAGAATGTTGACCAATGCTATGGAGGTTACGGGTCTGGATGGCAACTACAGAACCACATGCCACACTGTGATGGAAGTGCTCCGAGAGCACAAGGACAGTGTCATGGCTGTGCTGGAAGCCTTTGTCTATGACCCGCTGCTCAACTGGAGGCTGATGGACACGAATACCAAAGGCAATAAGCGGTCCCGGACAAGGACAGACTCCTACTCTGCCGGCCAGTCAGTAGAAATTTTGGACGGTGTAGAACTTGGAGAACCAGCCCATAAGAAAGCAGGGACCACTGTGCCAGAATCCATCCATTCATTCATTGGAGACGGTTTGGTGAAACCAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... Frap1(56717)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Benjamin Frank et al.
Parasites & vectors, 8, 404-404 (2015-08-01)
Autophagy participates in innate immunity by eliminating intracellular pathogens. Consequently, numerous microorganisms have developed strategies to impair the autophagic machinery in phagocytes. In the current study, interactions between Leishmania major (L. m.) and the autophagic machinery of bone marrow-derived macrophages
Hana Schmeisser et al.
Autophagy, 9(5), 683-696 (2013-02-20)
Autophagy is an evolutionarily conserved cellular recycling mechanism that occurs at a basal level in all cells. It can be further induced by various stimuli including starvation, hypoxia, and treatment with cytokines such as IFNG/IFNγ and TGFB/TGFβ. Type I IFNs
Clare F Malone et al.
Cancer discovery, 4(9), 1062-1073 (2014-06-11)
NF1 encodes a RAS GTPase-activating protein. Accordingly, aberrant RAS activation underlies the pathogenesis of NF1-mutant cancers. Nevertheless, it is unclear which RAS pathway components represent optimal therapeutic targets. Here, we identify mTORC1 as the key PI3K effector in NF1-mutant nervous
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU047451-50UG | 04061828283552 |
| EMU047451-20UG | 04061831347524 |