Skip to Content
Merck
CN

EMU046111

MISSION® esiRNA

targeting mouse Npy

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGACTGACCCTCGCTCTATCTCTGCTCGTGTGTTTGGGCATTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGCCAGATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGCCCTGAGACACTGATTTCAGACCTCTTAATGAAGGAAAGCACAGAAAACGCCCCCAGAACAAGGCTTGAAGACCCTTCCATGTGGTGATGGGAAATGAAACTTGTTCTCCCGACTTTTCCAAGTTTCCACCCTCATCTCATCTCATCCCCTGAAACCAGTCTGCCTGTCCCACCAATGCATGCCACCACTAGGCTGGACTCCGCCCCATTTCCCTTGTTGTTGTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sung-Hyeok Hong et al.
Oncotarget, 6(9), 7151-7165 (2015-02-26)
Ewing sarcoma (ES) develops in bones or soft tissues of children and adolescents. The presence of bone metastases is one of the most adverse prognostic factors, yet the mechanisms governing their formation remain unclear. As a transcriptional target of EWS-FLI1
Min Hee Park et al.
The EMBO journal, 34(12), 1648-1660 (2015-04-29)
Many reports have revealed the importance of the sympathetic nervous system (SNS) in the control of the bone marrow environment. However, the specific role of neuropeptide Y (NPY) in this process has not been systematically studied. Here we show that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service