Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EMU043271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rrm2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCACTGGGAAGCTCTGAAACCCGATGAGAGACATTTTATATCTCACGTTCTGGCTTTCTTTGCAGCGAGTGATGGCATAGTCAATGAGAACTTGGTGGAGCGATTTAGCCAAGAAGTTCAAGTTACAGAGGCCCGCTGTTTCTATGGCTTCCAAATTGCCATGGAAAACATACACTCTGAAATGTACAGTCTCCTTATTGACACTTACATTAAAGATCCCAAGGAAAGAGAATATCTCTTCAATGCTATTGAAACTATGCCTTGTGTGAAGAAGAAGGCTGACTGGGCCTTGCGCTGGATTGGGGACAAAGAGGCTACGTATGGAGAACGCGTTGTGGCCTTTGCCGCCGTAGAAGGAATCTTCTTTTCCGGTTCTTTTGCATCGATATTCTGGCTCAAGAAACGGGGGCTGATGCCGGGCCTTACATTTTCCAATGAGCTTATTAGCAGAGACGAGGGTTTACACTGTGACTTTGCCTGCCTGATGTTCAAGCACCTGGTACACAAGCCAGCGGAGCAGAGGGTCCGAGAGATAATCACCAACGCCG

Ensembl | mouse accession no.

ENSMUSG00000020649

NCBI accession no.

NM_009104

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... RRM2(20135) , Rrm2(20135)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Zejun Fang et al.
Biochemical and biophysical research communications, 464(2), 407-415 (2015-06-21)
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2
Nagireddy Putluri et al.
Neoplasia (New York, N.Y.), 16(5), 390-402 (2014-07-14)
Breast cancer (BCa) molecular subtypes include luminal A, luminal B, normal-like, HER-2-enriched, and basal-like tumors, among which luminal B and basal-like cancers are highly aggressive. Biochemical pathways associated with patient survival or treatment response in these more aggressive subtypes are
Kazuki Iwamoto et al.
International journal of oncology, 46(5), 1971-1977 (2015-03-05)
In our previous study, ribonucleotide reductase M2 (RRM2) was identified as a cancer-related gene commonly overexpressed in human oral squamous cell carcinoma (OSCC) cell lines. Herein, we attempted to determine whether targeting RRM2 may be a plausible therapeutic approach for
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service