Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EMU010191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gper

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTACCTAGGTCCCGTGTGGCCAGCCCCTTCCAACAGCACCCCTCTGGCCCTCAACTTGTCCCTGGCACTGCGGGAAGATGCCCCGGGGAACCTCACTGGGGACCTCTCTGAGCATCAGCAGTACGTGATTGCCCTCTTCCTCTCCTGCCTCTACACCATCTTCCTCTTTCCTATTGGCTTTGTGGGCAACATCCTCATCCTGGTGGTGAACATCAGCTTCCGGGAGAAGATGACCATCCCAGACCTGTACTTCATCAACCTGGCGGCGGCCGACCTCATCCTGGTGGCTGACTCCCTGATTGAGGTGTTCAACCTGGACGAGCAGTACTACGACATCGCAGTGCTCTGCACCTTCATGTCCCTCTTCCTGCAGATCAACATGTACAGCAGCGTCTTCTTCCTCACCTGGATGAGCTT

Ensembl | mouse accession no.

ENSMUSG00000053647

NCBI accession no.

NM_029771

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... GPER(76854) , Gper(76854)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rainer Girgert et al.
Breast cancer research and treatment, 134(1), 199-205 (2012-02-01)
Triple-negative breast cancers lack estrogen receptor α (ERα), progesterone receptor, and do not overexpress human epidermal growth factor receptor 2 (Her-2). They are neither susceptible to endocrine therapy nor to a therapy using the anti-Her-2 antibody, trastuzumab. Therefore, an efficient
Wenqing Cao et al.
PloS one, 7(12), e52838-e52838 (2013-01-04)
Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA) on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6), eicosapentaenoic acid (EPA
Whitney K Petrie et al.
Obstetrics and gynecology international, 2013, 472720-472720 (2014-01-01)
Endometrial carcinoma is the most common cancer of the female reproductive tract. GPER/GPR30 is a 7-transmembrane spanning G protein-coupled receptor that has been identified as the third estrogen receptor, in addition to ERα and ERβ. High GPER expression is predictive
Subhadeep Chakrabarti et al.
PloS one, 7(12), e52357-e52357 (2013-01-04)
Estrogen, the female sex hormone, is known to exert anti-inflammatory and anti-atherogenic effects. Traditionally, estrogen effects were believed to be largely mediated through the classical estrogen receptors (ERs). However, there is increasing evidence that G-protein coupled receptor 30 (GPR30), a
Nicolas Chevalier et al.
PloS one, 7(4), e34672-e34672 (2012-04-13)
Testicular germ cell tumours are the most frequent cancer of young men with an increasing incidence all over the world. Pathogenesis and reasons of this increase remain unknown but epidemiological and clinical data have suggested that fetal exposure to environmental
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service