Skip to Content
Merck
CN

EMU007041

MISSION® esiRNA

targeting mouse Dusp1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGGCACCTCTACTACCACAGTCTTCAACTTCCCTGTTTCCATCCCCGTCCACCCCACGAACAGTGCCCTGAACTACCTTAAAAGCCCCATCACCACCTCTCCAAGCTGCTGAAGGGCAAGGGGAGGTGTGGAGTTTCACTTGCCACCGGGTCGCCACTCCTCCTGTGGGAGGAGCAATGCAATAACTCTGGGAGAGGCTCATGGGAGCTGGTCCTTATTTATTTAACACCCCCCTCACCCCCCAACTCCTCCTGAGTTCCACTGAGTTCCTAAGCAGTCACAACAATGACTTGACCGCAAGACATTTGCTGAACTCGGCACATTCGGGACCAATATATTGTGGGTACATCAAGTCCCTCTGACAAAACAGGGCAGAAGAGAAAGGACTCTGTTTGAGGCAGTTTCTTCGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chaoyong He et al.
Diabetes, 64(12), 4285-4297 (2015-04-11)
Activation of AMPK suppresses inflammation, but the underlying mechanisms remain poorly understood. This study was designed to characterize the molecular mechanisms by which AMPK suppresses vascular inflammation. In cultured human aortic smooth muscle cells, pharmacologic or genetic activation of AMPK
Brijeshkumar S Patel et al.
Cancer biology & therapy, 16(5), 780-789 (2015-03-17)
Mitogen activated protein kinase phosphatase-1 (MKP-1) has emerged as an important protein mediating breast cancer oncogenesis and chemoresistance to cancer chemotherapies, especially proteasome inhibitors. In this in vitro study, we utilized the breast cancer epithelial cell lines MCF-7 and MDA-MB-231
Maria M Talavera et al.
Pediatric research, 78(2), 128-136 (2015-05-08)
Necrotizing enterocolitis is characterized by intestinal inflammation and epithelial barrier dysfunction. Mitogen-activated protein kinase (MAPK) phosphatase (MKP)-1 plays a pivotal role in the feedback control of MAPK signaling, which regulates inflammation and apoptosis. We hypothesized that MKP-1 prevents lipopolysaccharide (LPS)-induced

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service