Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGTGGTGAACTTCCCTGTGGAGCCTGGTACCCTGGGTGGTGCAGCTCCATACCAGCTGCCTGCTCACTGCCTGTTTCCCTGGTGTGGCTTGCTGCTGGACACTCAGACTTTGGAGGTGTTCTGTGACTACTCAGGTTATGCCCAGACCTCAATTAAGACGAGCCTCACCTTCCAGAGTGTCTTCAAAGCTGGGAAGACCATGCGGAACAAGCTCCTGTCGGTCTTGCGGTTGAAGTGTCACGGTCTATTTCTAGACTTGCAGGTGAACAGCCTCCAGACAGTCTGCATCAATATATACAAGATCTTCCTGCTTCAGGCCTACAGGTTCCATGCATGTGTGATTCAGCTTCCCTTTGACCAGCGTGTTAGGAAGAACCTCACATTCTTTCTGGGCATCATCTCC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TERT(21752), Tert(21752)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ki Chan Kim et al.
Molecular neurobiology, 53(10), 7312-7328 (2015-12-24)
In addition to its classical role as a regulator of telomere length, recent reports suggest that telomerase reverse transcriptase (TERT) plays a role in the transcriptional regulation of gene expression such as β-catenin-responsive pathways. Silencing or over-expression of TERT in
T Liu et al.
British journal of cancer, 108(11), 2272-2280 (2013-05-18)
Telomerase and telomerase reverse transcriptase (hTERT) confer cancer cells sustained proliferation and survival potentials. Targeting telomerase or hTERT is a novel anti-cancer strategy. However, telomerase/hTERT inhibition alone has minimal clinical efficacy. We explored the relationship between hTERT and cyclooxygenase 2
Xin Tian et al.
Evidence-based complementary and alternative medicine : eCAM, 2015, 546210-546210 (2016-01-20)
Bufalin, a digoxin-like active component of the traditional Chinese medicine Chan Su, exhibits potent antitumor activities in many human cancers. Bufalin induces mitochondria-dependent apoptosis in cancer cells, but the detailed molecular mechanisms are largely unknown. hTERT, the catalytic subunit of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU001801-50UG | 04061828433926 |
| EMU001801-20UG | 04061828659722 |