Select a Size
CN¥927.94
Available to ship onApril 27, 2025Details
Select a Size
About This Item
CN¥927.94
Available to ship onApril 27, 2025Details
form
lyophilized
lyophilized powder
esiRNA cDNA target sequence
TCCGCTTTGACAAGAGGATTGAGGCCGAAGAGGCTATCAAAGGACTGAATGGGCAGAAGCCGCTGGGCGCAGCTGAGCCCATCACAGTCAAGTTCGCGAACAACCCAAGTCAGAAGACGGGGCAGGCGCTGCTCACCCACCTCTACCAGTCATCCGCCCGGCGCTACGCAGGCCCCCTACACCATCAGACCCAGCGTTTCCGGCTGGACAATTTGCTCAACATGGCCTACGGCGTCAAGA
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ELAVL3(1995)
1 of 4
This Item | 86477 | 49598 | 86473 |
|---|---|---|---|
| assay ≥95.0% (sum of enantiomers, GC) | assay ≥98.0% (sum of enantiomers, GC) | assay ≥95.0% (sum of enantiomers, GC) | assay ≥95.0% (GC) |
| Quality Level 100 | Quality Level 100 | Quality Level 100 | Quality Level - |
| density 0.934 g/mL at 20 °C | density 0.933 g/mL at 20 °C (lit.) | density 0.934 g/mL at 20 °C | density 0.837 g/mL at 25 °C (lit.) |
| refractive index n20/D 1.479 | refractive index n20/D 1.479 | refractive index - | refractive index n20/D 1.478 (lit.) |
| optical activity [α]20/D -25±6°, neat | optical activity - | optical activity [α]/D -25±6°, neat | optical activity - |
| optical purity enantiomeric ratio: ~2:1 | optical purity enantiomeric ratio: ~2:1 | optical purity enantiomeric ratio: ~2:1 | optical purity - |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
11 - Combustible Solids
WGK
WGK 1
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
