Skip to Content
Merck
CN

EHU158871

MISSION® esiRNA

targeting human TRADD

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human TRADD

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGAGAACGAGCTCACCAGCCTGGCAGAGGACTTGCTGGGCCTGACCGATCCCAATGGCGGCCTGGCCTAGACCAGGGGTGCAGCCAGCTTTTGGAGAACCTGGATGGCCTTAGGGTTCCTTCTGCGGCTATTGCTGAACCCCTGTCCATCCACGGGACCCTGAAACTCCACTTGGCCTATCTGCTGGACCTGCTGGGGCAGAGTTGATTGCCTTCCCCAGGAGCCAGACCACTGGGGGTGCATCATTGGGGATTCTGCCTCAGGTACTTTGATAGAGTGTGGGGTGGGGGGGACCTGCTTTGGAGATCAGCCTCACCTTCTCCCATCCCAGAAGCGGGGCTTACAGCCAGCCCTTACAGTTTCACTCATGAAGCACCTTGATCTTTGGTGTCCTGGACTTCATCCTGGGTGCTGCAGATAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tian-Ping Chen et al.
Molecular medicine (Cambridge, Mass.), 27(1), 21-21 (2021-03-05)
Studies have found that circular RNAs (circRNAs) play key roles in cardiovascular diseases. However, the function of circROBO2 in acute myocardial infarction (AMI) is unclear. This study aimed to investigate the pathogenesis of circROBO2 in AMI. qRT-PCR and Western blot
Hua Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(5), 1063-1078 (2016-12-14)
Chronic lung infection in cystic fibrosis leads to an inflammatory response that persists because of the chronic presence of bacteria and ultimately leads to a catastrophic failure of lung function. We use a combination of biochemistry, cell and molecular biology
Ganqian Zhu et al.
Journal of immunology (Baltimore, Md. : 1950), 198(3), 1104-1118 (2017-01-01)
The apoptosis of glomerular mesangial cells (GMCs) in the early phase of rat Thy-1 nephritis (Thy-1N), a model of human mesangioproliferative glomerulonephritis (MsPGN), is primarily triggered by sublytic C5b-9. However, the mechanism of GMC apoptosis induced by sublytic C5b-9 remains

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service