Skip to Content
Merck
CN

EHU157051

MISSION® esiRNA

targeting human MCM10

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAAGCTGCTGGAGACCTGCGTCAGTGAGCAGCATGAATACCACTGGCATGATGGTGTGAAGAGGTTTTTCAAATGTCCCTGTGGAAACAGAAGCATCTCCTTGGACAGACTCCCGAACAAGCACTGCAGTAACTGTGGCCTCTACAAATGGGAACGGGACGGAATGCTAAAGGAAAAGACTGGTCCAAAGATAGGAGGAGAAACTCTGTTACCAAGAGGAGAAGAACATGCTAAATTTCTGAACAGCCTTAAATAACCCGAACTTCAGACATTTTCCCACAGACTTCCTGGCCTCCTGTGACTCTGGAAAGCAAAGGATTGGCTGTGTATTGTCCATTGATTCCTGATTGACGCCGTCAAAAACAAATGCTTGTTAAGCCCATAAGCTTTGCCTGCTTACTTTCTGCCATTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... MCM10(55388)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peng Kang et al.
Journal of molecular neuroscience : MN, 70(5), 759-768 (2020-02-08)
Minichromosome maintenance 10 (MCM10) plays an important role in DNA replication and is expressed in a variety of tumors, including glioma. However, its role and mechanism in glioma remain elusive. The purpose of this study was to examine the molecular
Feilun Cui et al.
The Prostate, 78(16), 1299-1310 (2018-08-11)
Prostate cancer (PCa) is one of the most malignant tumors of the male urogenital system. There is an urgent need to identify novel biomarkers for PCa. In this study, we evaluated the expression levels of MCM10 in prostate cancer by
Wei-Dong Yang et al.
Journal of biochemical and molecular toxicology, 33(7), e22330-e22330 (2019-04-17)
The minichromosome maintenance protein 10 (MCM10) is one of the MCM proteins that initiate DNA replication by interacting with CDC45-MCM2-7. It has been reported that MCM10 has a role in breast cancer progression. However, MCM10 in breast cancer is still not comprehensively
Bizhan Romani et al.
The Journal of biological chemistry, 290(28), 17380-17389 (2015-06-03)
Human immunodeficiency virus type 1 Vpr is an accessory protein that induces G2/M cell cycle arrest. It is well documented that interaction of Vpr with the Cul4-DDB1[VprBP] E3 ubiquitin ligase is essential for the induction of G2/M arrest. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service