Skip to Content
Merck
CN

EHU156781

MISSION® esiRNA

targeting human TRPV4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGAGGTCATTACGCTCTTCACTGGGGTCCTGTTCTTCTTCACCAACATCAAAGACTTGTTCATGAAGAAATGCCCTGGAGTGAATTCTCTCTTCATTGATGGCTCCTTCCAGCTGCTCTACTTCATCTACTCTGTCCTGGTGATCGTCTCAGCAGCCCTCTACCTGGCAGGGATCGAGGCCTACCTGGCCGTGATGGTCTTTGCCCTGGTCCTGGGCTGGATGAATGCCCTTTACTTCACCCGTGGGCTGAAGCTGACGGGGACCTATAGCATCATGATCCAGAAGATTCTCTTCAAGGACCTTTTCCGATTCCTGCTCGTCTACTTGCTCTTCATGATCGGCTACGCTTCAGCCCTGGTCTCCCTCCTGAACCCGTGTGCCAACATGAAGGTGTGCAATGAGGACCAGACCAACTGCACAGTGCCCACTTACCCCTCGTGCCGTGACAGCGAGACCTTCAGCACCTTCCTCCTGGACCTGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... TRPV4(59341)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yuanzheng Gu et al.
The Journal of cell biology, 216(7), 2179-2199 (2017-06-14)
Little is known about mechanical regulation of morphological and functional polarity of central neurons. In this study, we report that mechanical stress specifically induces varicosities in the axons but not the dendrites of central neurons by activating TRPV4, a Ca
Hengli Zhao et al.
Frontiers in molecular neuroscience, 11, 97-97 (2018-04-11)
Blood-brain barrier (BBB) disruption and subsequent brain edema play important roles in the secondary neuronal death and neurological dysfunction that are observed following intracerebral hemorrhage (ICH). In previous studies, transient receptor potential vanilloid 4 (TRPV4), a calcium-permeable mechanosensitive channel, was
Tatsuya Ihara et al.
Neurourology and urodynamics, 37(8), 2535-2543 (2018-08-15)
The sensation of bladder fullness (SBF) is triggered by the release of ATP. Therefore, the aim of this study was to investigate whether time-dependent changes in the levels of stretch-released ATP in mouse primary-cultured urothelial cells (MPCUCs) is regulated by
Min Li et al.
Biochemical and biophysical research communications, 513(4), 1005-1012 (2019-04-22)
Transient Receptor Potential Vanilloid 4 (TRPV4) ion channel is thought to be an essential component of inflammatory response. However, its role and mechanism in regulating acute lung injury (ALI) and macrophages activation are not well characterized. In our study, we
Bo Xu et al.
Life sciences, 228, 158-166 (2019-05-06)
Chondrocyte apoptosis is the most common pathological feature of cartilage in osteoarthritis (OA). Excessive mechanical stress can induce chondrocyte apoptosis and destroy cartilage tissue. Transient receptor potential channel vanilloid 4 (TRPV4) is a mechanosensitive ion channel that mediates chondrocyte response

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service