Skip to Content
Merck
CN

EHU156731

MISSION® esiRNA

targeting human P2RY2

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGTAGCGAGAACACTAAGGACATTCGGCTGTAGGAGCAGAACACTTCAGCCTGTGCAGGTTTATATTGGGAAGCTGTAGAGGACCAGGACTTGTGCAGACGCCACAGTCTCCCCAGATATGGACCATCAGTGACTCATGCTGGATGACCCCATGCTCCGTCATTTGACAGGGGCTCAGGATATTCACTCTGTGGTCCAGAGTCAACTGTTCCCATAACCCCTAGTCATCGTTTGTGTGTATAAGTTGGGGGAATTAAGTTTCAAGAAAGGCAAGAGCTCAAGGTCAATGACACCCCTGGCCTGACTCCCATGCAAGTAGCTGGCTGTACTGCCAAGGTACCTAGGTTGGAGTCCAGCCTAATCAAGTCAAATGGAGAAACAGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jiang-Lan Zhang et al.
Cancer science, 108(7), 1318-1327 (2017-05-06)
Extracellular adenosine 5'-triphosphate (ATP), secreted by living cancer cells or released by necrotic tumor cells, plays an important role in tumor invasion and metastasis. Our previous study demonstrated that ATP treatment in vitro could promote invasion in human prostate cancer
Hana Jin et al.
International journal of oncology, 53(5), 1953-1966 (2018-09-19)
In the tumor microenvironment, extracellular nucleotides are released and accumulate, and can activate the P2Y2 receptor (P2Y2R), which regulates various responses in tumor cells, resulting in tumor progression and metastasis. Moreover, the inflammasome has recently been reported to be associated
Hana Jin et al.
International journal of molecular sciences, 21(9) (2020-05-14)
The inflammasomes are reported to be associated with tumor progression. In our previous study, we determined that extracellular ATP enhances invasion and tumor growth by inducing inflammasome activation in a P2Y purinergic receptor 2 (P2Y2R)-dependent manner. However, it is not
So Young Eun et al.
Oncology reports, 34(1), 195-202 (2015-06-13)
Tumor metastasis is considered the main cause of mortality in cancer patients, thus it is important to investigate the differences between high- and low-metastatic cancer cells. Our previous study showed that the highly metastatic breast cancer cell line MDA-MB-231 released
Virginie Bondu et al.
Molecular biology of the cell, 28(21), 2887-2903 (2017-08-25)
Pathogenic hantaviruses bind to the plexin-semaphorin-integrin (PSI) domain of inactive, β

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service