Skip to Content
Merck
CN

EHU153781

MISSION® esiRNA

targeting human SDC1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGCAGGACTTCACCTTTGAAACCTCGGGGGAGAATACGGCTGTAGTGGCCGTGGAGCCTGACCGCCGGAACCAGTCCCCAGTGGATCAGGGGGCCACGGGGGCCTCACAGGGCCTCCTGGACAGGAAAGAGGTGCTGGGAGGGGTCATTGCCGGAGGCCTCGTGGGGCTCATCTTTGCTGTGTGCCTGGTGGGTTTCATGCTGTACCGCATGAAGAAGAAGGACGAAGGCAGCTACTCCTTGGAGGAGCCGAAACAAGCCAACGGCGGGGCCTACCAGAAGCCCACCAAACAGGAGGAATTCTATGCCTGACGCGGGAGCCATGCGCCCCCTCCGCCCTGCCACTCACTAGGCCCCCACTTGCCTCTTCCTTGAAGAACTGCAGGCCCTGGCCTCCCCTGCCACCAGGCCACCTCCCCAGCATTCCAGCCCCTCTGGTCGCTCCTGCCCACGGAGTCGTGGGGTGTGCTGGGAGCTCCACTCTGCTTCTCTGACTTCTGCCTGGAGACTTAGGGCACCAGGGGTTTCTCGCATAGGACCTTTCCACCACAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SDC1(6382)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhou Jing et al.
Cell biology international, 44(3), 894-904 (2019-12-24)
Disabled-2 (Dab2) and PAR-3 (partitioning defective 3) are reported to play critical roles in maintaining retinal microvascular endothelial cells biology by regulating VEGF-VEGFR-2 signaling. The role of Dab2 and PAR-3 in glomerular endothelial cell (GEnC) is unclear. In this study
Saritha Adepu et al.
American journal of physiology. Renal physiology, 309(2), F137-F145 (2015-05-15)
Syndecan-1 is a transmembrane heparan sulfate proteoglycan involved in regenerative growth and cellular adhesion. We hypothesized that the induction of tubular syndecan-1 is a repair response to incipient renal damage in apparently stable, uncomplicated renal transplant recipients. We quantified tubular
Shiyu Hu et al.
Frontiers in microbiology, 11, 105-105 (2020-03-11)
Porcine hemagglutinating encephalomyelitis virus (PHEV) is a single-stranded RNA coronavirus that causes nervous dysfunction in the infected hosts and leads to widespread alterations in the host transcriptome by modulating specific microRNA (miRNA) levels. MiRNAs contribute to RNA virus pathogenesis by
Ildiko Kasza et al.
PLoS genetics, 10(8), e1004514-e1004514 (2014-08-08)
Homeostatic temperature regulation is fundamental to mammalian physiology and is controlled by acute and chronic responses of local, endocrine and nervous regulators. Here, we report that loss of the heparan sulfate proteoglycan, syndecan-1, causes a profoundly depleted intradermal fat layer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service