Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGGTGTCCGAGAAGTCAGGCACGTAGCTCAGCGGCGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCAATGTGGGCTGGAACAACTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MIF(4282)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mei Zhang et al.
Molecular carcinogenesis, 58(6), 898-912 (2019-01-23)
Macrophage migration inhibitory factor (MIF) is a prominent orchestrator during the onset and progression of cancer. Recently, MIF was detected in salivary adenoid cystic carcinoma (SACC). However, its functional effect in perineural invasion (PNI) of SACC remained unknown. To illuminate
Milica Jovanović Krivokuća et al.
Reproduction, fertility, and development (2020-12-17)
Extravillous trophoblasts are specific placental cells that invade the uterine stroma and spiral arteries modifying and adjusting them to pregnancy. Many pregnancy pathologies are associated with impairment of this process, including preeclampsia and intrauterine growth restriction, among others. Macrophage migration
Yong-Chao Jiang et al.
Journal of biomedical materials research. Part A, 106(6), 1595-1603 (2018-02-11)
During the process of tissue regeneration facilitated by stem cells, physical properties of a scaffold affect behavior and activities of the cell. To enhance differentiation of human mesenchymal stem cells (MSCs) into endothelial-like cells (ELCs), we used electrospun fibrous substrates
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU147971-20UG | 04061831366082 |
| EHU147971-50UG | 04061828427802 |