Skip to Content
Merck
CN

EHU145171

MISSION® esiRNA

targeting human IL10

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... IL10(3586)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hyeon-Soo Lee et al.
Journal of cellular and molecular medicine, 19(7), 1538-1547 (2015-06-11)
Although the mechanisms by which hyperoxia promotes bronchopulmonary dysplasia are not fully defined, the inability to maintain optimal interleukin (IL)-10 levels in response to injury secondary to hyperoxia seems to play an important role. We previously defined that hyperoxia decreased
Rodrigo Liberal et al.
Hepatology (Baltimore, Md.), 62(3), 863-875 (2015-05-09)
Defective immune regulation plays a permissive role enabling effector cells to initiate and perpetuate tissue damage, eventually resulting in autoimmune disease. Numerical and functional regulatory T-cell (Treg) impairment has been previously reported in autoimmune liver disease (AILD; including autoimmune hepatitis
Sandip Mukherjee et al.
Journal of immunology (Baltimore, Md. : 1950), 193(8), 4083-4094 (2014-09-14)
The efflux of antimony through multidrug resistance protein (MDR)-1 is the key factor in the failure of metalloid treatment in kala-azar patients infected with antimony-resistant Leishmania donovani (Sb(R)LD). Previously we showed that MDR-1 upregulation in Sb(R)LD infection is IL-10-dependent. Imipramine

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service