Skip to Content
Merck
CN

EHU140771

MISSION® esiRNA

targeting human ANO1

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCCGACGAAGAAGATGTACCACATTAATGAGACCCGTGGCCTCCTGAAAAAAATCAACTCTGTGCTCCAGAAAATCACAGATCCCATCCAGCCCAAAGTGGCTGAGCACAGGCCCCAGACCATGAAGAGACTCTCCTATCCCTTCTCCCGGGAGAAGCAGCATCTATTTGACTTGTCTGATAAGGATTCCTTTTTCGACAGCAAAACCCGGAGCACGATTGTCTATGAGATCTTGAAGAGAACGACGTGTACAAAGGCCAAGTACAGCATGGGCATCACGAGCCTGCTGGCCAATGGTGTGTACGCGGCTGCATACCCACTGCACGATGGAGACTACAACGGTGAAAACGTCGAGTTCAACGACAGAAAACTCCTGTACGAAGAGTGGGCACGCTATGGAGTTTTCTATAAGTACCAGCCCATCGACC

Ensembl | human accession no.

ENSG00000131620

NCBI accession no.

NM_018043

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
EXS
RPS
WAS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huan Lian et al.
Biochemical and biophysical research communications, 487(2), 201-208 (2017-04-11)
Diabetic nephropathy (DN) is one of the most common microvascular complication of diabetes mellitus (DM) as well as the main reason resulting in chronic renal failure. Transmembrane protein 16A (TMEM16A) plays an important role in multiple physiological actions. Here we
Shenbin Liu et al.
British journal of pharmacology, 173(7), 1208-1218 (2016-01-13)
TMEM16A, also known as anoctamin 1 channel, is a member of the Ca(2+)-activated chloride channels family and serves as a heat sensor in the primary nociceptors. Eact is a recently discovered small molecule activator of the TMEM16A channel. Here, we
Fang Liu et al.
Oncotarget, 6(13), 11585-11599 (2015-04-04)
TMEM16A is a newly identified calcium activated chloride channel, and has been reported to be overexpressed by various solid malignant cancers to promote proliferation and invasion, yet little is known about its role in gastric cancer(GC). Therefore, we investigated the
Chuantao Zhang et al.
International journal of clinical oncology, 25(6), 1145-1154 (2020-04-03)
Increase of the Ca2+-activated chloride channel TMEM16A is contribute to tumorigenesis. However, the expression level of TMEM16A and its underlying molecular mechanism for TMEM16Apromotingliver carcinogenesis is remains unknown. In the present study, the expression of TMEM16A in hepatocellular carcinoma (HCC)
Liang Deng et al.
OncoTargets and therapy, 9, 325-333 (2016-02-03)
TMEM16A plays an important role in cell proliferation in various cancers. However, less was known about the expression and role of TMEM16A in hepatocellular carcinoma. We screened the expression of TMEM16A in patients' hepatocellular carcinoma tissues, and also analyzed the
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service