Skip to Content
Merck
CN
All Photos(1)

Key Documents

Safety Information

EHU135861

Sigma-Aldrich

MISSION® esiRNA

targeting human DSG3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTGCAGACAAAGATGGAGAAGGACTATCAACTCAATGTGAATGTAATATTAAAGTGAAAGATGTCAACGATAACTTCCCAATGTTTAGAGACTCTCAGTATTCAGCACGTATTGAAGAAAATATTTTAAGTTCTGAATTACTTCGATTTCAAGTAACAGATTTGGATGAAGAGTACACAGATAATTGGCTTGCAGTATATTTCTTTACCTCTGGGAATGAAGGAAATTGGTTTGAAATACAAACTGATCCTAGAACTAATGAAGGCATCCTGAAAGTGGTGAAGGCTCTAGATTATGAACAACTACAAAGCGTGAAACTTAGTATTGCTGTCAAAAACAAAGCTGAATTTCACCAATCAGTTATCTCTCGATACCGAGTTCAGTCAACCCCAGTCACAATTCAGGTAATAAATGTAAGAGAAGGAATTGCATTCCGTCCTGCTTCCAAGACATTTACTGTGCAAAAAGGCATAAGTAGCAAAAAATTGGTGGATTATATCCTGGGAACATATCAAGCCATCGATGAGGACACTAACAAAGCTGCCTCAAATGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Han Ri et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 118, 109214-109214 (2019-08-06)
To investigate the effects of desmoglein 3 (DSG3) gene mediating epidermal growth factor/epidermal growth factor receptor (EGF/EGFR) signaling pathway on inflammatory response and immune function of anaphylactic rhinitis (AR). Ten of the seventy male BALB/c mice were randomly selected as
Yuan Yan et al.
Theranostics, 10(22), 9970-9983 (2020-09-16)
Background: Induced pluripotent stem cells (iPSCs) have emerged as a promising treatment paradigm for skin wounds. Extracellular vesicles are now recognized as key mediators of beneficial stem cells paracrine effects. In this study, we investigated the effect of iPSCs-derived microvesicles
Jutamas Uttagomol et al.
International journal of molecular sciences, 20(24) (2019-12-15)
Desmoglein 3 (Dsg3) plays a crucial role in cell-cell adhesion and tissue integrity. Increasing evidence suggests that Dsg3 acts as a regulator of cellular mechanotransduction, but little is known about its direct role in mechanical force transmission. The present study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service