Skip to Content
Merck
CN

EHU134441

MISSION® esiRNA

targeting human CDKN2B

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGACTTGGCCGAGGAGCGGGGCCACCGCGACGTTGCAGGGTACCTGCGCACAGCCACGGGGGACTGACGCCAGGTTCCCCAGCCGCCCACAACGACTTTATTTTCTTACCCAATTTCCCACCCCCACCCACCTAATTCGATGAAGGCTGCCAACGGGGAGCGGCGGAAAGCCTGTAAGCCTGCAAGCCTGTCTGAGACTCACAGGAAGGAGGAGCCGACCGGGAATAACCTTCCATACATTTTTTTCTTTGTCTTATCTGGCCCTCGACACTCACCATGAAGCGAAACACAGAGAAGCGGATTTCCAGGGATATTTAGGAGTGTGTGACATTCCAGGGGTCGTTTGCTTTTCAGGGTTTTCTGAGGGAAAGTGCATATGAAATCCTTGACTGGACCTGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jiangeng Yang et al.
Oncotarget, 8(40), 68721-68729 (2017-10-06)
Hsa-miR-429 is increased in bladder cancer. Its roles in bladder cancer are poorly understood. The expression levels of hsa-miR-429 and cyclin-dependent kinase inhibitor 2B (CDKN2B) were determined using Real-Time qPCR in a total of 50 patients with bladder cancer. Bladder
Steven K Huang et al.
PloS one, 9(9), e107055-e107055 (2014-09-13)
Excessive fibroproliferation is a central hallmark of idiopathic pulmonary fibrosis (IPF), a chronic, progressive disorder that results in impaired gas exchange and respiratory failure. Fibroblasts are the key effector cells in IPF, and aberrant expression of multiple genes contributes to
Mu Xu et al.
Molecular cancer, 17(1), 141-141 (2018-09-30)
Mounting evidence demonstrates that long noncoding RNAs (lncRNAs) have critical roles during the initiation and progression of cancers. In this study, we report that the small nucleolar RNA host gene 1 (SNHG1) is involved in colorectal cancer progression. We analyzed
Anne M Scruggs et al.
American journal of respiratory cell and molecular biology, 59(2), 200-214 (2018-02-09)
Idiopathic pulmonary fibrosis (IPF) is a devastating lung disease characterized by excessive scarring and fibroblast activation. We previously showed that fibroblasts from patients with IPF are hypermethylated at the CDKN2B gene locus, resulting in decreased CDKN2B expression. Here, we examine
Zhong Zheng et al.
The Journal of clinical investigation, 129(8), 3236-3251 (2019-07-16)
Tumorigenicity is a well-documented risk to overcome for pluripotent or multipotent cell applications in regenerative medicine. To address the emerging demand for safe cell sources in tissue regeneration, we established a novel, protein-based reprogramming method that does not require genome

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service