Skip to Content
Merck
CN

EHU132901

MISSION® esiRNA

targeting human SIRT6

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGGTGGGGCTTTTTGTAGAAACTGTGGATTCTTTTTCTCTCGTGGTCTCACTTTGTTACTTGTTTCTGTCCCCGGGAGCCTCAGGGCTCTGAGAGCTGTGCTCCAGGCCAGGGGTTACACCTGCCCTCCGTGGTCCCTCCCTGGGCTCCAGGGGCCTCTGGTGCGGTTCCGGGAAGAAGCCACACCCCAGAGGTGACAGGTGAGCCCCTGCCACACCCCAGCCTCTGACTTGCTGTGTTGTCCAGAGGTGAGGCTGGGCCCTCCCTGGTCTCCAGCTTAAACAGGAGTGAACTCCCTCTGTCCCCAGGGCCTCCCTTCTGGGCCCCCTACAGCCCACCCTACCCCTCCTCCATGGGCCCTGCAGGAGGGGAGACCCACCTTGAAGTGGGGGATCAGTAGAGGCTTGCACTGCCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ganye Zhao et al.
Aging, 8(10), 2308-2323 (2016-10-31)
Sirtuin6(SIRT6) has been implicated as a key factor in aging and aging-related diseases. However, the role of SIRT6 in cellular senescence has not been fully understood. Here, we show that SIRT6 repressed the expression of p27Kip1 (p27) in cellular senescence.
Ming-Yue Cheng et al.
American journal of translational research, 8(11), 5005-5015 (2016-12-03)
The present study explored changes of the SIRT6/NF-κB pathway in myocardial hypoxia/reoxygenation induced injury and the effects on mitochondrial damage and myocardial damage by regulating SIRT6. SIRT6 expression decreased and NF-κB expression increased in H9c2 cells during hypoxic injury. Cell
Ning Qu et al.
International journal of oncology, 50(5), 1683-1692 (2017-04-11)
Sirtuin 6 (SIRT6) is a member of the SIRT family NAD+‑dependent deacetylases reported to function in controlling organism homeostasis, lifespan, and diseases. This study investigated the role of SIRT6 in papillary thyroid cancer (PTC). Data of 391 PTC patients was extracted
Yujuan Yang et al.
European journal of pharmacology, 859, 172516-172516 (2019-07-03)
Angiotensin II (Ang II) is a vasoactive peptide that elevates arterial blood pressure and leads to hypertension. Ang II has been reported to induce endothelial dysfunction by induction of apoptosis and oxidative stress in vascular endothelial cells. Sirtuin6 (SIRT6) has
Varunkumar Krishnamoorthy et al.
Genomics, 112(5), 3703-3712 (2020-05-04)
Sirtuins (SIRT1-7), are NAD-dependent deacetylases and ADP-ribosyl transferases, plays a major part in carcinogenesis. The previous report suggests that in cancer, sirtuins gained tremendous interest and critical regulators of the unusual processes. In carcinogenesis, sirtuins possess either tumor suppressor or

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service