Sign In to View Organizational & Contract Pricing
Select a Size
About This Item
UNSPSC Code:
41105324
NACRES:
NA.51
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGTGGACAAGGTCCTGGAGCGAGACCAGAAGCTGTCGGAGCTGGACGACCGTGCAGATGCACTCCAGGCGGGGGCCTCCCAGTTTGAAACAAGCGCAGCCAAGCTCAAGCGCAAATACTGGTGGAAAAACCTCAAGATGATGATCATCTTGGGAGTGATTTGCGCCATCATCCTCATCATCATCATAGTTTTCTTTTCTGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VAMP2(6844), VAMP2(6844)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
A novel Netrin-1-sensitive mechanism promotes local SNARE-mediated exocytosis during axon branching.
Cortney C Winkle et al.
The Journal of cell biology, 205(2), 217-232 (2014-04-30)
Developmental axon branching dramatically increases synaptic capacity and neuronal surface area. Netrin-1 promotes branching and synaptogenesis, but the mechanism by which Netrin-1 stimulates plasma membrane expansion is unknown. We demonstrate that SNARE-mediated exocytosis is a prerequisite for axon branching and
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service