Skip to Content
Merck
CN

EHU126811

MISSION® esiRNA

targeting human MRC1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGTGGAAGAAGAAGCAGTCTTTCTTATGAAGATGCTGACTGTGTTGTTATTATTGGAGGTGCATCAAATGAAGCAGGAAAATGGATGGATGATACCTGCGACAGTAAACGAGGCTACATATGCCAGACACGATCCGACCCTTCCTTGACTAATCCTCCAGCAACGATTCAAACAGATGGCTTTGTTAAATATGGCAAAAGCAGCTATTCACTCATGAGACAAAAATTTCAATGGCATGAAGCGGAGACATACTGCAAGCTTCACAATTCCCTTATAGCCAGCATTCTGGATCCCTACAGTAATGCATTTGCGTGGCTGCAGATGGAAACATCTAATGAACGTGTGTGGATCGCCCTGAACAGTAACTTGACTGATAATCAATACACTTGGACTGATAAGTGGAGGGTGAGGTACACTAACTGGGCTGCTGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinjian Huang et al.
Bioactive materials, 6(3), 770-782 (2020-10-08)
Herein, we report the synthesis of a biomimic hydrogel adhesive that addresses the poor healing of surgical anastomosis. Dopamine-conjugated xanthan gum (Da-g-Xan) is fabricated using deep insights into the molecular similarity between mussels' adhesive and dopamine as well as the
Gregor Olmes et al.
Arthritis research & therapy, 18, 90-90 (2015-01-01)
The role of macrophages in the pathogenesis of lupus nephritis, in particular their differentiation to a certain subtype (e.g., M1- or M2-like) modulating the inflammatory reaction, is unknown. Here we investigated whether the differentiation in M1- or M2-like macrophages depends
Tae-Wook Chung et al.
Oncotarget, 8(3), 4436-4448 (2016-12-30)
Tumor-derived gangliosides in the tumor microenvironment are involved in the malignant progression of cancer. However, the molecular mechanisms underlying the effects of gangliosides shed from tumors on macrophage phenotype remain unknown. Here, we showed that ganglioside GM1 highly induced the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service