Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTACATCGCCGACCATCTCGACCACTTCAGCCCCCTGATTGAGGGCGACGTGGGGGAGTTTATCATCGCTGCTGCCCAAGACGGGGCATGGGCCGGGTACCCGGAGTTGCTGGCCATGGGGCAGATGCTGAATGTGAATATCCATTTAACTACTGGAGGGAGGCTGGAGAGTCCCACGGTGTCTACCATGATTCATTATTTGGGCCCAGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
Gene Information
human ... OTUD1(220213)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shudong Piao et al.
Cellular signalling, 33, 22-29 (2017-02-22)
Ubiquitination and deubiquitination pathways play important roles in the regulation of p53 stability and activity. p53 is ubiquitinated and destabilized by E3 ubiquitin ligases and is deubiquitinated and stabilized by deubiquitinases (DUBs). We screened ovarian tumor (OTU) subfamily proteins to
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service