Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAATGCACTTGATGTGGTCTTGCACATGTGGGTGATAGAGTTGGGTTCCTTTTTATGCTGGGTGTACAGGTGGGTTTGGGAGAGAGGAGCATGCGCGAGAGAGTCTCCGAGTGTGTGCGACGCGTGTGTGTGTGGTGGGTTGTCTGTGTGCATATGTCCTGCCCGTGTATATGCACCCACACCATGTGCCCGTGCACACCAGTGACTACGCAGTCCCCCCTTTCTGGTTTAGCTGTGGGAAGATCTGAATCTGGGGCCGTTTGAAAGCAAAAACAAACCACTGTCTCTGCTTCTGAAACGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guillaume Jacquemet et al.
Nature communications, 7, 13297-13297 (2016-12-03)
Mounting in vitro, in vivo and clinical evidence suggest an important role for filopodia in driving cancer cell invasion. Using a high-throughput microscopic-based drug screen, we identify FDA-approved calcium channel blockers (CCBs) as potent inhibitors of filopodia formation in cancer
Bei Li et al.
Bone research, 8, 19-19 (2020-05-01)
The loss-of-function mutations in the ALPL result in hypophosphatasia (HPP), an inborn metabolic disorder that causes skeletal mineralization defects. In adults, the main clinical features are early loss of primary or secondary teeth, osteoporosis, bone pain, chondrocalcinosis, and fractures. However
Hyun Su Lee et al.
Molecular medicine reports, 12(3), 4782-4788 (2015-06-24)
5‑Fluorouracil (5‑FU), one of the oldest anticancer therapeutic agents, is increasingly being administered in cancer chemotherapy. In the present study, the anticancer effects of 5‑FU combined with corosolic acid (CRA) were determined in SNU‑620 human gastric carcinoma cells and the
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service