Select a Size
¥811.31
Available to ship on2025年4月27日Details
Select a Size
About This Item
¥811.31
Available to ship on2025年4月27日Details
Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TATTGTCCTGGTGGCTGGATCCCTCAGTTTGGTGACCATTATCGGGAACATCCTAGTCATGGTTTCCATTAAAGTCAACCGCCACCTCCAGACCGTCAACAATTACTTTTTATTCAGCTTGGCCTGTGCTGACCTTATCATAGGTGTTTTCTCCATGAACTTGTACACCCTCTACACTGTGATTGGTTACTGGCCTTTGGGACCTGTGGTGTGTGACCTTTGGCTAGCCCTGGACTATGTGGTCAGCAATGCCTCAGTTATGAATCTGCTCATCATCAGCTTTGACAGGTACTTCTGTGTCACAAAACCTCTGACCTACCCAGTCAAGCGGACCACAAAAATGGCAGGTATGATGATTGCAGCTGCCTGGGTCCTCTCTTTCATCCTCTGGGCTCCAGCCATTCTCTTCTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CHRM2(1129) , CHRM2(1129)
Related Categories
1 of 4
This Item | ABN240 | MABN640 | MABN13 |
|---|---|---|---|
| clone 6C3, monoclonal | clone polyclonal | clone M98, monoclonal | clone G2-13, monoclonal |
| biological source mouse | biological source rabbit | biological source rabbit | biological source mouse |
| antibody form purified immunoglobulin | antibody form affinity isolated antibody | antibody form purified antibody | antibody form purified antibody |
| Gene Information human ... APP(351) | Gene Information human ... APP(351) | Gene Information human ... APP(351) | Gene Information human ... APP(351) |
| species reactivity human | species reactivity human | species reactivity human | species reactivity human |
| shipped in wet ice | shipped in wet ice | shipped in wet ice | shipped in wet ice |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
