Skip to Content
Merck
CN

EHU120691

MISSION® esiRNA

targeting human RAC2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human RAC2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGACCTGCCTTCTCATCAGCTACACCACCAACGCCTTTCCCGGAGAGTACATCCCCACCGTGTTTGACAACTATTCAGCCAATGTGATGGTGGACAGCAAGCCAGTGAACCTGGGGCTGTGGGACACTGCTGGGCAGGAGGACTACGACCGTCTCCGGCCGCTCTCCTATCCACAGACGGACGTCTTCCTCATCTGCTTCTCCCTCGTCAGCCCAGCCTCTTATGAGAACGTCCGCGCCAAGTGGTTCCCAGAAGTGCGGCACCACTGCCCCAGCACACCCATCATCCTGGTGGGCACCAAGCTGGACCTGCGGGACGACAAGGACACCATCGAGAAACTGAAGGAGAAGAAGCTGGCTCCCATCACCTACCCGCAGGGCCTGGCACTGGCCAAGGAGATTGACTCGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hailong Pei et al.
Cell cycle (Georgetown, Tex.), 16(1), 113-122 (2016-12-10)
Our recent study showed that quiescent G0 cells are more resistant to ionizing radiation than G1 cells; however, the underlying mechanism for this increased radioresistance is unknown. Based on the relatively lower DNA damage induced in G0 cells, we hypothesize
Peng Xia et al.
International journal of biological macromolecules, 137, 1221-1231 (2019-07-07)
Osteosarcoma (OS) is the most common primary malignancy of bone and is characterized by a high malignant and metastatic potential. Microarray-based differentially expressed gene screening determined RAC2 as the candidate gene related to OS. Highly expressed RAC2 and activated Wnt
Xu Zhang et al.
Cancer medicine, 8(12), 5716-5734 (2019-08-08)
The aim of this study is to investigate the functions and mechanisms of miR-608 in prostate cancer (PCa). CISH and qRT-PCR analysis demonstrated that miR-608 was low expressed in PCa tissues and cells, which was partly attributed to the methylation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service