Skip to Content
Merck
CN

EHU113801

MISSION® esiRNA

targeting human MATR3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human MATR3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCATTCATGTTGCAGCAGTCTACAAATCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCATTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTGGGTGCTGGAAATGGAAACCTGCAAGGACCTAGACACATGCAGAAAGGCAGAGTGGAAACTAGCAGAGTTGTTCACATCATGGATTTTCAACGAGGGAAAAACTTGAGATACCAGCTATTACAGCTGGTAGAACCATTTGGAGTCATTTCAAATCATCTGATTCTAAATAAAATTAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Haruka Kuriyama et al.
Journal of dermatological science, 100(2), 110-119 (2020-09-19)
A previous study revealed that matrin-3 is an essential component in maintaining fibroblast growth factor 2 (FGF2)-mediated undifferentiation of neural stem cells (NSCs) using a proteomics approach. Malignant melanoma (MM) arises from melanocytes that originate from neural crest stem cells
Su-Hyun Nho et al.
Oncology reports, 41(1), 333-340 (2018-10-16)
Licochalcone H (LCH) is a chemical compound that is a positional isomer of licochalcone C (LCC), a chalconoid isolated from the root of Glycyrrhiza inflata, which has various pharmacological properties including anti‑inflammatory, antioxidant, antitumor, and anticancer effects. However, the efficacy of LCH
Ambra Sarracino et al.
mBio, 9(6) (2018-11-15)
Posttranscriptional regulation of HIV-1 replication is finely controlled by viral and host factors. Among the former, Rev controls the export of partially spliced and unspliced viral RNAs from the nucleus and their translation in the cytoplasm or incorporation into new

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service