Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU113211

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN1

Sign Into View Organizational & Contract Pricing

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGCTAAGAAGGCGATTACTGCAATCTTTGACCAGTTACTGGAGTTTGTTACTGAAGGATCACATTTTGTTGAAGCAACATATAAGAATCCGGAACTTGATCGAATAGCCACTGAAGATGATCTGGTAGAAATGCAAGGATATAAAGACAAGCTTTCCATCATTGGTGAGGTGCTATCTCGGAGACACATGAAGGTGGCATTTTTTGGCAGGACAAGCAGTGGGAAGAGCTCTGTTATCAATGCAATGTTGTGGGATAAAGTTCTCCCTAGTGGGATTGGCCATATAACCAATTGCTTCCTAAGTGTTGAAGGAACTGATGGAGATAAAGCCTATCTTATGACAGAAGGATCAGATGAAAAAAAGAGTGTGAAGACAGTTAATCAACTGGCCCATGCCCTTCACATGGACAAAGATTTGAAAGCTGGCTGTCTTGTACGTGTGTTTTGGCCAAAAGCAAAATGTGCCCTCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sarah L Sawyer et al.
Human molecular genetics, 24(18), 5109-5114 (2015-06-19)
Multiple symmetric lipomatosis (MSL) is a mitochondrial disorder with impaired brown fat metabolism that has been associated with MERRF mutations in some, but not all, patients. We studied a sibling pair and an unrelated indiviadual who presented with MSL and
Qian Zhou et al.
Vascular pharmacology, 72, 163-171 (2015-05-28)
Angiogenesis is defined as the sprouting of capillaries from pre-existing vasculature. It is a complex process that includes endothelial proliferation, migration, and tube formation. Previous data have demonstrated a high expression level of manganese-superoxide dismutase (MnSOD) in endothelial cells and
Chih-Wei Chen et al.
International journal of molecular sciences, 21(14) (2020-07-28)
NME3 is a member of the nucleoside diphosphate kinase (NDPK) family that binds to the mitochondrial outer membrane to stimulate mitochondrial fusion. In this study, we showed that NME3 knockdown delayed DNA repair without reducing the cellular levels of nucleotide
Irene Bertolini et al.
Developmental cell, 55(2), 163-177 (2020-08-12)
The crosstalk between tumor cells and the adjacent normal epithelium contributes to cancer progression, but its regulators have remained elusive. Here, we show that breast cancer cells maintained in hypoxia release small extracellular vesicles (sEVs) that activate mitochondrial dynamics, stimulate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service