Skip to Content
Merck
CN
All Photos(1)

Documents

Safety Information

EHU112501

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPB1

Sign Into View Organizational & Contract Pricing
All Photos(1)
UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCA

Ensembl | human accession no.

ENSG00000106211

NCBI accession no.

NM_001540

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HSPB1(3315) , HSPB1(3315)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ah-Mee Park et al.
PloS one, 11(2), e0148998-e0148998 (2016-02-10)
Heat shock protein 27 (HSP27) is a member of the small molecular weight HSP family. Upon treatment with transforming growth factor β1 (TGF-β1), we observed upregulation of HSP27 along with that of α-smooth muscle actin (α-SMA), a marker of myofibroblast
Eva Hadadi et al.
Scientific reports, 6, 39035-39035 (2016-12-16)
Monocytes play a central role in regulating inflammation in response to infection or injury, and during auto-inflammatory diseases. Human blood contains classical, intermediate and non-classical monocyte subsets that each express characteristic patterns of cell surface CD16 and CD14; each subset
Su-Feng Chen et al.
PloS one, 7(11), e49275-e49275 (2012-11-16)
Treatment failure in oral squamous cell carcinoma (OSCC) leading to local recurrence(s) and metastases is mainly due to drug resistance. Cancer stem cells (CSCs) are thought be responsible for the development of drug resistance. However, the correlations between CSCs, drug
Jong-Rung Tsai et al.
PloS one, 9(3), e91331-e91331 (2014-03-13)
Heat-shock proteins (HSPs) are molecular chaperones that protect proteins from damage. HSP27 expression is associated with cancer transformation and invasion. Ginkgo biloba extract (EGb761), the most widely sold herbal supplement, has antiangiogenic effects and induces tumor apoptosis. Data regarding the
Soo-Yeon Hwang et al.
European journal of medicinal chemistry, 139, 892-900 (2017-09-05)
Heat Shock Protein 27 (HSP27) is a member of small heat shock proteins with a highly-conserved α-crystalline domain. It inhibits aggregation of damaged proteins through a complex structural systems of phosphorylation-dependent oligomerization and self-assembly. It has been demonstrated that HSP27
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service