Skip to Content
Merck
CN

EHU111181

MISSION® esiRNA

targeting human KPNA2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human KPNA2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAAGGCTGTGGTAGATGGAGGTGCCATCCCAGCATTCATTTCTCTGTTGGCATCTCCCCATGCTCACATCAGTGAACAAGCTGTCTGGGCTCTAGGAAACATTGCAGGTGATGGCTCAGTGTTCCGAGACTTGGTTATTAAGTACGGTGCAGTTGACCCACTGTTGGCTCTCCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGCTACTTACGTAATCTTACCTGGACACTTTCTAATCTTTGCCGCAACAAGAATCCTGCACCCCCGATAGATGCTGTTGAGCAGATTCTTCCTACCTTAGTTCGGCTCCTGCATCATGATGATCCAGAAGTATTAGCAGATACCTGCTGGGCTATTTCCTACCTTACTGATGGTCCAAATGAACGAATTGGCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jia He et al.
Autophagy, 16(12), 2238-2251 (2020-09-15)
KPNA2/importin-alpha1 (karyopherin subunit alpha 2) is the primary nucleocytoplasmic transporter for some transcription factors to activate cellular proliferation and differentiation. Aberrant increase of KPNA2 level is identified as a prognostic marker in a variety of cancers. Yet, the turnover mechanism
Kamalakannan Radhakrishnan et al.
International journal of molecular sciences, 21(7) (2020-04-16)
Mediator of DNA damage checkpoint protein 1 (MDC1) plays a vital role in DNA damage response (DDR) by coordinating the repair of double strand breaks (DSBs). Here, we identified a novel interaction between MDC1 and karyopherin α-2 (KPNA2), a nucleocytoplasmic
Jie-Xin Huang et al.
OncoTargets and therapy, 12, 11475-11486 (2020-01-11)
Karyopherin alpha 2 (KPNA2) has been reported as an oncogenic protein in numerous human cancers and is currently considered a potential therapeutic target. However, the transcriptional regulation and physiological conditions underlying KPNA2 expression remain unclear. The aim of the present

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service