Skip to Content
Merck
CN

EHU110021

MISSION® esiRNA

targeting human SLC25A5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGGAGCTGAAAGGGAATTCCGAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAAGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTATTATCATCTACCGAGCCGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCGGATCCCAAGAACACTCACATCGTCATCAGCTGGATGATCGCACAGACTGTCACTGCTGTTGCCGGGTTGACTTCCTATCCATTTGACACTGTTCGCCGCCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGACATCATGTACACAGGCACGCTTGACTGCTGGCGGAAGATTGCTCGTGATGAAGGAGGCAAAGCTTTTTTCAAGGGTGCATGGTCCAATGTTCTCAGAGGCATGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SLC25A5(292)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Linh Ho et al.
Aging, 5(11), 835-849 (2013-12-04)
Efficient coupling of cellular energy production to metabolic demand is crucial to maintain organismal homeostasis. Here, we report that the mitochondrial Sirtuin Sirt4 regulates mitochondrial ATP homeostasis. We find that Sirt4 affects mitochondrial uncoupling via the adenine nucleotide translocator 2
Yun Choi et al.
BMC cancer, 13, 143-143 (2013-03-26)
It is important to simultaneously induce strong cell death and antitumor immunity in cancer patients for successful cancer treatment. Here, we investigated the cytotoxic and phenotypic modulation effects of the combination of ANT2 shRNA and human sodium iodide symporter (hNIS)
Ji-Young Jang et al.
Experimental & molecular medicine, 45, e3-e3 (2013-01-12)
MicroRNAs (miRNAs) participate in diverse biological functions and carcinogenesis by inhibiting specific gene expression. We previously reported that suppression of adenine nucleotide translocase 2 (ANT2) by using the short hairpin RNA (shRNA) approach has an antitumor effect in several cancer
Ji-Young Jang et al.
Molecular cancer, 9, 262-262 (2010-09-30)
Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL; apo2 ligand) induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer
Ji-Young Jang et al.
Breast cancer research : BCR, 10(1), R11-R11 (2008-02-13)
Adenine nucleotide translocator (ANT) 2 is highly expressed in proliferative cells, and ANT2 induction in cancer cells is known to be directly associated with glycolytic metabolisms and carcinogenesis. In addition, ANT2 repression results in the growth arrest of human cells

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service