Skip to Content
Merck
CN

EHU109121

MISSION® esiRNA

targeting human GBA

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCCTGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAACGACCTGGACGCAGTGGCACTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTGCCTCTTACCATCAAGGATCCTGCTGTGGGCTTCCTGGAGACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGGCGTCGCCAGTGATGGAGCAGATACTCAAGGAGGCACTGGGCTCAGCCTGGGCATTAAAGGGACAGAGTCAGCTCACACGCTGTCTGTGACTAAAGAGGGCACAGCAGGGCCAGTGTGAGCTTACAGCGACGTAAGCCCAGGGGCAATGGTTTGGGTGACTCACTTTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... GBA(2629)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tiziana Squillaro et al.
Journal of cellular physiology, 232(12), 3454-3467 (2017-01-18)
Lysosomal storage disorders (LDS) comprise a group of rare multisystemic diseases resulting from inherited gene mutations that impair lysosomal homeostasis. The most common LSDs, Gaucher disease (GD), and Fabry disease (FD) are caused by deficiencies in the lysosomal glucocerebrosidase (GBA)
Kecheng Zhou et al.
The American journal of pathology, 190(10), 2018-2028 (2020-07-18)
Studies of lysosome associated protein transmembrane 4B (LAPTM4B) have mainly focused on the 35-kDa isoform and its association with poor prognosis in cancers. Here, by employing a novel monoclonal antibody, the authors found that the 24-kDa LAPTM4B isoform predominated in
Jong-Won Lim et al.
Human molecular genetics, 24(17), 4817-4828 (2015-06-05)
Facioscapulohumeral muscular dystrophy (FSHD) is caused by the aberrant expression of the DUX4 transcription factor in skeletal muscle. The DUX4 retrogene is encoded in the D4Z4 macrosatellite repeat array, and smaller array size or a mutation in the SMCHD1 gene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service