Skip to Content
Merck
CN

EHU106681

MISSION® esiRNA

targeting human ATP6AP2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGTTCACTCCCCCTCAATTCTCTGAGTAGGAACAATGAAGTTGACCTGCTCTTTCTTTCTGAACTGCAAGTGCTACATGATATTTCAAGCTTGCTGTCTCGTCATAAGCATCTAGCCAAGGATCATTCTCCTGATTTATATTCACTGGAGCTGGCAGGTTTGGATGAAATTGGGAAGCGTTATGGGGAAGACTCTGAACAATTCAGAGATGCTTCTAAGATCCTTGTTGACGCTCTGCAAAAGTTTGCAGATGACATGTACAGTCTTTATGGTGGGAATGCAGTGGTAGAGTTAGTCACTGTCAAGTCATTTGACACCTCCCTCATTAGGAAGACAAGGACTATCCTTGAGGCAAAACAAGCGAAGAACCCAGCAAGTCCCTATAACCTTGCATATAAGTATAATTTTGAATATTCCGTGGTTTTCAACATGGTACTTTGGATAATGATCGCCTTGGCCTTGGCTGTGATTATCACCTCTTACAATATTTGGAACATGGATCCTGGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... ATP6AP2(10159)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ting-Ting Chang et al.
European journal of clinical investigation, 46(6), 544-554 (2016-04-12)
Endothelial progenitor cell (EPC) functions are impaired in the presence of diabetes mellitus. Aliskiren is a direct renin inhibitor, which is expected to modify proangiogenic cells. This study aimed to investigate whether and how aliskiren could improve the function of
Kaori Narumi et al.
Scientific reports, 8(1), 16-16 (2018-01-10)
(Pro)renin receptor [(P)RR] is expressed in the kidney and is involved in renal injury. Although (P)RR is activated by indoxyl sulfate (IS) and may be related to renal injury, the details remain unclear. We used mouse mesangial cell line SV40
Nehman Makdissy et al.
Stem cell research & therapy, 9(1), 132-132 (2018-05-13)
The subcellular distribution of prorenin receptor and adaptor protein ATP6AP2 may affect neurogenesis. In this study, we hypothesized that ATP6AP2 expression and subcellular relocalization from caveolae/lipid raft microdomains (CLR-Ms) to intracellular sites may correlate with neuronal differentiation (Neu-Dif) of adipose-derived
Juan Wang et al.
British journal of cancer, 120(2), 229-237 (2018-12-18)
Although constitutive activating mutations in the Wnt/β-catenin signalling pathway are important for colorectal cancer development, canonical signalling through Wnt ligands is essential for β-catenin activation. Here, we investigated the role of (pro)renin receptor ((P)RR), a component of the Wnt receptor
Asadur Rahman et al.
Molecular cancer therapeutics, 19(9), 1844-1855 (2020-07-17)
We previously reported that silencing of the PRR gene, which encodes the (pro)renin receptor [(P)RR], significantly reduced Wnt/β-catenin-dependent development of pancreatic ductal adenocarcinoma (PDAC). Here, we examined the effects of a panel of blocking mAbs directed against the (P)RR extracellular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service