Skip to Content
Merck
CN

EHU104461

MISSION® esiRNA

targeting human AZGP1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCCCAGGAGAACCAAGATGGTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCGCGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACAGGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGGACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATCGTGGAGTATTACAACGACAGTAACGGGTCTCACGTATTGCAGGGAAGGTTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAGCATTCTGGAAATATTACTATGATGGAAAGGACTACATTGAATTCAACAAAGAAATCCCAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... AZGP1(563)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xinhua Xiao et al.
Molecular and cellular endocrinology, 439, 155-164 (2016-06-07)
Zinc alpha2 glycoprotein (ZAG) plays an important role in stimulating fat mobilization and lipolysis in adipose tissue, but its role in hepatic lipid metabolism remains unclear. Palmitic acid (PA) was used to stimulate HepG2 cells with ZAG overexpression or ZAG
Yingming Xue et al.
International journal of molecular sciences, 16(1), 691-703 (2015-01-07)
Zinc-α-2-glycoprotein (AZGP1) is a 41-kDa secreted glycoprotein, which has been detected in several malignancies. The diagnostic value of AZGP1 in serum of prostate and breast cancer patients has been reported. Analyzing "The Cancer Genome Atlas" data, we found that in
P M Sanders et al.
British journal of cancer, 90(6), 1274-1278 (2004-03-18)
Lipid-mobilising factor (LMF) is produced by cachexia-inducing tumours and is involved in the degradation of adipose tissue, with increased oxidation of the released fatty acids through an induction of uncoupling protein (UCP) expression. Since UCP-2 is thought to be involved

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service