Sign In to View Organizational & Contract Pricing.
Select a Size
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCTCTGACAAGGGCAACTACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTCGTGGAGCGGTCCCCTCACCGGCCCATCCTGCAAGCAGGGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGTACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGCAAGATTGGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGACTGCTGGAGTTAATACCACCGACAAAGAGATGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Quality Level
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jiexia Zhang et al.
International journal of oncology, 54(6), 2211-2221 (2019-04-04)
Emerging reports have revealed that several microRNAs (miRNAs) are abnormally expressed in non‑small cell lung cancer (NSCLC). miRNAs have been identified as oncogenes or tumor suppressors, and regulate various biological processes including oncogenesis and development. miR‑802 is dysregulated in multiple
Yuanxia Huang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 85, 41-46 (2016-12-09)
Cartilage degeneration is known as a major cause of osteoarthritis (OA). C1q/TNF-related protein-3 (CTRP3) is an adipokine relative to chondrogenesis in vitro. However, its effect on cartilage degeneration in OA remains unclearly. In the present study, SW1353 cells were treated
Fei Ma et al.
Journal of experimental & clinical cancer research : CR, 36(1), 158-158 (2017-11-15)
MicroRNAs function as key regulators in various human cancers, including breast cancer (BC). MiR-361-5p has been proved to be a tumor suppressor in colorectal cancer and gastric cancer in our previous study. In this study, we aim to find out
Liyan Wang et al.
FEBS letters, 590(23), 4252-4262 (2016-10-23)
MiR-296 was previously reported to be underexpressed in hepatocellular carcinoma (HCC). However, the clinical value of miR-296 and its function in HCC remain poorly understood. In this study, we found that miR-296 levels are decreased in HCC specimens and cells
Tetsuya Kawane et al.
Scientific reports, 8(1), 13551-13551 (2018-09-12)
Runx2 and Sp7 are essential transcription factors for osteoblast differentiation. However, the molecular mechanisms responsible for the proliferation of osteoblast progenitors remain unclear. The early onset of Runx2 expression caused limb defects through the Fgfr1-3 regulation by Runx2. To investigate
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service