description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Regulatory Information
新产品
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jiajia Li et al.
Biochemical and biophysical research communications, 523(2), 434-440 (2019-12-27)
Ovarian cancer is the most lethal gynecological malignancy, but the mechanisms of ovarian cancer progression and cisplatin resistance remain unclear. Emerging evidence suggested that ubiquitin-conjugating enzyme E2C (UBE2C) was highly expressed in a variety of tumors and acted as an
Masanori Saito et al.
Scientific reports, 6, 20622-20622 (2016-02-11)
Skeletal development is tightly regulated through the processes of chondrocyte proliferation and differentiation. Although the involvement of transcription and growth factors on the regulation of skeletal development has been extensively studied, the role of cell cycle regulatory proteins in this
To senesce or not to senesce: how primary human fibroblasts decide their cell fate after DNA damage.
Gabriel Kollarovic et al.
Aging, 8(1), 158-177 (2016-02-03)
Excessive DNA damage can induce an irreversible cell cycle arrest, called senescence, which is generally perceived as an important tumour-suppressor mechanism. However, it is unclear how cells decide whether to senesce or not after DNA damage. By combining experimental data
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Maria Sokolova et al.
Cell cycle (Georgetown, Tex.), 16(2), 189-199 (2016-12-09)
To identify cell cycle regulators that enable cancer cells to replicate DNA and divide in an unrestricted manner, we performed a parallel genome-wide RNAi screen in normal and cancer cell lines. In addition to many shared regulators, we found that
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service