Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGGTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAGGTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGTCCAGTCGAAGATTGGGTCCCTGGACAATATCACCCACGTCCCTGGCGGAGGAAATAAAAAGATTGAAACCCACAAGCTGACCTTCCGCGAGAACGCCAAAGCCAAGACAGACCACGGGGCGGAGATCGTGTACAAGTCGCCAGTGGTGTCTGGGGACACGTCTCCACGGCATCTCAGCAATGTCTCCTCCACCGGCAGCATCGACATGGTAGACTCGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MAPT(4137)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sheng Yi et al.
Journal of cell science, 132(6) (2019-02-21)
Tau protein (encoded by the gene microtubule-associated protein tau, Mapt) is essential for the assembly and stability of microtubule and the functional maintenance of the nervous system. Tau is highly abundant in neurons and is detectable in astrocytes and oligodendrocytes.
Tomi Rantamäki et al.
PloS one, 8(7), e68722-e68722 (2013-07-12)
Brain-derived neurotrophic factor (BDNF) importantly regulates learning and memory and supports the survival of injured neurons. Reduced BDNF levels have been detected in the brains of Alzheimer's disease (AD) patients but the exact role of BDNF in the pathophysiology of
Varun Balaji et al.
Autophagy, 14(12), 2139-2154 (2018-08-28)
Missorting of MAPT/Tau represents one of the early signs of neurodegeneration in Alzheimer disease. The triggers for this are still a matter of debate. Here we investigated the sorting mechanisms of endogenous MAPT in mature primary neurons using microfluidic chambers
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU098701-50UG | 04061828355204 |
| EHU098701-20UG | 04061828589548 |